ROUGE

Gene/Protein Characteristic Table for mKIAA1608

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220407
Description :
Clone Name :	mkg10115 [Vector Info]
Source :	Mouse adult kidney

Features of the cloned DNA sequence	Description

Length: 4095 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1042 bp

Genome contig ID gi66880554r_37631157
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
AAATTGATTCCTTTCAATAAACCAAGGTAAAACAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AGACTGACCGTTTAAGAAAACATCCATCAGAGACATGCAGGAAATTGTGC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1608 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1608	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 85..999, 1431..3053
Length: 845 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL08718	5.6e-159	82.6	DENN/MADD domai...	Mus musculus
XP_001478838	5.7e-159	82.6	hypothetical pr...	Mus musculus
AAH27786	5.7e-159	82.5	DENN/MADD domai...	Mus musculus
Q8K382	5.7e-159	82.6	DENN domain-con...	Mus musculus
EDM00519	2.9e-146	76.2	similar to RIKE...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK081176	4.8e-05	27.8	mKIAA1277

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001194 71 246 PF02141 DENN

ProfileScan IPR001194 108 246 PS50211 DENN

IPR000694 478 829 PS50099 Proline-rich region

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001194	71	246	PF02141	DENN
ProfileScan	IPR001194	108	246	PS50211	DENN
IPR000694	478	829	PS50099	Proline-rich region

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	1042 bp
Genome contig ID	gi66880554r_37631157
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- AAATTGATTCCTTTCAATAAACCAAGGTAAAACAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AGACTGACCGTTTAAGAAAACATCCATCAGAGACATGCAGGAAATTGTGC

Gene/Protein Characteristic Table for mKIAA1608

Features of the cloned DNA sequence

Features of the protein sequence