Gene/Protein Characteristic Table for mKIAA3020

Length: 6083 bp

Restriction map

Length of 3'UTR	340 bp
Genome contig ID	gi65543215r_89241161
PolyA signal sequence (TATAAA,-19)	+----*----+----*----+----*----+---- CTAGAACCAGAGTCTATATAAAGAGAGAACTAACG
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* ACACAATTGTACGCCTGCATCAGCACTGCATCAGACTGTGGGTCTGCCCA

Coding region: 89..5740

Length: 1884 aa

Entry Exp ID% Protein Source Q6ZPE2 0 100.0 Myotubularin-re... Mus musculus AAI57936 0 99.9 Sbf1 protein [M... Mus musculus AAI72094 0 99.9 Sbf1 protein [M... Mus musculus NP_001074499 0 99.6 SET binding fac... Mus musculus O95248 0 94.9 Myotubularin-re... Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK173257 1.9e-88 60.3 mKIAA1766 AF262986 5.9e-18 27.0 mKIAA0647 AK220524 8.3e-18 33.4 mKIAA4176 AK220369 1.1e-13 37.4 mKIAA1073 AK122539 6.6e-10 27.4 mKIAA1682

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR005113	18	103	PF03456	uDENN
	IPR001194	145	327	PF02141	DENN
	IPR005112	380	449	PF03455	dDENN
	IPR004182	899	985	PF02893	GRAM
	IPR010569	1176	1269	PF06602	Myotubularin-related
	IPR001849	1779	1882	PF00169	Pleckstrin-like
HMMSmart	IPR001849	1779	1884	SM00233	Pleckstrin-like
ProfileScan	IPR001194	188	327	PS50211	DENN
	IPR001849	1778	1882	PS50003	Pleckstrin-like

Method	From	To	amino acid sequence
-	-	-	-