ROUGE |
Gene/Protein Characteristic Table for mKIAA0851 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122390 |
---|---|
SAC1 (supressor of actin mutations 1, homolog)-like. polyphosphatidylinositol phosphatase. |
|
mbh00089 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3498 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1661 bp Genome contig ID gi65519420f_123453522 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
TCCATATGCAAAAATAAAATGCCATATTCTTTTCTFlanking genome sequence
(162783 - 162832) ----+----*----+----*----+----*----+----*----+----*
AACCGCTGTTGGTACTGTTTCTCTGTTTTTATCGTGTTTTTTTTTTAATC
KIAA Alignment based on: KIAA0851 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..1837
Length: 611 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |