ROUGE

Gene/Protein Characteristic Table for mKIAA0966

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129249
Description :	inositol polyphosphate-5-phosphatase F. cDNA sequence, clone 3-26.
Clone Name :	mpm04106 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 4530 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 944 bp

Genome contig ID gi65511124f_122560094
PolyA signal sequence
(ATTAAA,-22)
+----*----+----*----+----*----+----
AAGTCTTGTGACTATTAAAAGAACCACTGTAATTC
Flanking genome sequence
(185639 - 185688)
----+----*----+----*----+----*----+----*----+----*
AAAACATCAGCGTATGAGAATTTCTTGTATAGCATTTAATAGTAAGAGTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0966 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0966	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 77..3586
Length: 1169 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q8CDA1	100.0	Phosphatidylino...	Mus musculus
EDM17166	94.3	inositol polyph...	Rattus norvegicus
XP_001927491	89.4	inositol polyph...	Sus scrofa
XP_508074	90.6	inositol polyph...	Pan troglodytes
Q9Y2H2	90.4	Phosphatidylino...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122390	5.7e-38	37.3	mKIAA0851
AB093272	2.9e-22	28.0	mKIAA0910
AK129122	5.5e-22	35.3	mKIAA0348
AK172926	8.3e-07	30.3	mKIAA0274

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002013 85 459 PF02383 Synaptojanin

ProfileScan IPR002013 204 555 PS50275 Synaptojanin

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002013	85	459	PF02383	Synaptojanin
ProfileScan	IPR002013	204	555	PS50275	Synaptojanin

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	944 bp
Genome contig ID	gi65511124f_122560094
PolyA signal sequence (ATTAAA,-22)	+--------+--------+----*----+---- AAGTCTTGTGACTATTAAAAGAACCACTGTAATTC
Flanking genome sequence (185639 - 185688)	----+--------+--------+--------+--------+----* AAAACATCAGCGTATGAGAATTTCTTGTATAGCATTTAATAGTAAGAGTT

Gene/Protein Characteristic Table for mKIAA0966

Features of the cloned DNA sequence

Features of the protein sequence