ROUGE

Gene/Protein Characteristic Table for mKIAA0274

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK172926
Description :	Sac domain-containing inositol phosphatase 3.
Clone Name :	mnh11265 [Vector Info]
Source :	Mouse NKT cells

Features of the cloned DNA sequence	Description

Length: 2311 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 350 bp

Genome contig ID gi65524842r_41195790
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
ACTAATTGCAGGTAATAAAGAAATGCTGCCTCTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
TGCTGGTTTTGCTTCTGACTTATTTTAGGAGAAATTCACATTATGAAACG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0274 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0274	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..1961
Length: 652 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL04967	100.0	RIKEN cDNA A530...	Mus musculus
Q91WF7	100.0	SAC domain-cont...	Mus musculus
BAE42839	99.8	unnamed protein...	Mus musculus
EDL83245	96.6	rCG38206, isofo...	Rattus norvegicus
ABG56230	96.6	SAC3 [Rattus no...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122390	5e-08	31.4	mKIAA0851
AK129249	4e-07	30.6	mKIAA0966
AB093272	2.8e-05	31.0	mKIAA0910
AK129122	0.00011	29.8	mKIAA0348

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002013 1 175 PF02383 Synaptojanin

ProfileScan IPR002013 1 292 PS50275 Synaptojanin

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002013	1	175	PF02383	Synaptojanin
ProfileScan	IPR002013	1	292	PS50275	Synaptojanin

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	350 bp
Genome contig ID	gi65524842r_41195790
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- ACTAATTGCAGGTAATAAAGAAATGCTGCCTCTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TGCTGGTTTTGCTTCTGACTTATTTTAGGAGAAATTCACATTATGAAACG

Gene/Protein Characteristic Table for mKIAA0274

Features of the cloned DNA sequence

Features of the protein sequence