KIAA0851

Product ID	ORK00658
Accession No	AB020658
Description	SAC1 suppressor of actin mutations 1-like (yeast)
Clone name	hk06032
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone hk06032 has an irregular adapter sequence (GTCGACCCAC GCGTCCGCCC ACGCGTCCG) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (3572 bp) Predicted protein sequence (607 aa)
HaloTag ORF Clone	FHC00658
Flexi ORF Clone	FXC00658
Source	Human adult brain
Rouge ID	mKIAA0851 by Kazusa Mouse cDNA Project

Length: 3572 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	1739 bp
Genome contig ID	gi89161205f_45605933
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TCCATAAGTGAAAATAAAATGTCATATTCTTTTCT
Flanking genome sequence (155973 - 156022)	----+--------+--------+--------+--------+----* ATTATTGGTATCATTCATGTACTTTGAAAGTGATGTTTTTCTTTTTGATC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	f	45705893	45761904	20	100.0	Perfect prediction

Length: 607 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q9NTJ5	100.0	Phosphatidylino...	Homo sapiens
Q5R921	99.8	Phosphatidylino...	Pongo abelii
AAH16559	99.8	SAC1 suppressor...	Homo sapiens
BAF83831	99.7	unnamed protein...	Homo sapiens
CAB66765	99.7	hypothetical pr...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB023183	2.1e-53	38.0	KIAA0966
AB020717	2.7e-36	30.6	KIAA0910
AB002346	3.5e-33	30.9	KIAA0348
D87464	5e-11	28.4	KIAA0274

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002013	77	372	PF02383	Synaptojanin
ProfileScan	IPR002013	142	471	PS50275	Synaptojanin

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	541	FLALPIIMVVAFSMCIICLLMAG	563	PRIMARY	23
SOSUI2	2	574	LFWGVASIGTFFIILYNGKDFVD	596	SECONDARY	23

Primer_f	TAGCTGGAAAACCCTCTGTAG
Primer_r	CATTCCCTACAAAGCAGCCAC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	UniGene
Primer_f	-
Primer_r	-
PCR product length	-
PCR conditions	-