ROUGE |
Gene/Protein Characteristic Table for mKIAA0846 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK173041 |
---|---|
RAS guanyl releasing protein 3. | |
mfj18276 [Vector Info] | |
Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4558 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2200 bp Genome contig ID gi65550231f_73146262 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
TGTACCTTCAATGAAAAATAAACATACACAAAAAGFlanking genome sequence
(193003 - 193052) ----+----*----+----*----+----*----+----*----+----*
AAATAAAGTGTGTATTGTATGTATGTAGATAGCTTGTGTCTGCCTGTGGA
KIAA Alignment based on: KIAA0846 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 277..2358
Length: 693 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |