ROUGE

Gene/Protein Characteristic Table for mKIAA4254

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122422
Description :
Clone Name :	mbg00605 [Vector Info]
Source :	Mouse brain
Note :	The gene name of mbg00605 was changed from mKIAA1032 to mKIAA4254, because this gene is not a mouse ortholog of KIAA1032

Features of the cloned DNA sequence	Description

Length: 6874 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 2510 bp

Genome contig ID gi65493515f_42993026
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
ATTATAGGGTAGACTTTAATAAATTATCTTATAGC
Flanking genome sequence
(187769 - 187818)
----+----*----+----*----+----*----+----*----+----*
AGCTTTTGGAGTCTGGAATTCTGTGAATATGTGAAAACTATAAAAATGTC

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 1563..4361
Length: 933 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
CAM16525	99.8	unc-13 homolog ...	Mus musculus
AAC52267	98.6	Munc13-2.	Rattus norvegicus
CAM14326	99.6	unc-13 homolog ...	Mus musculus
AAI57968	99.6	Unc13b protein ...	Mus musculus
CAM14327	99.6	unc-13 homolog ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173041	3.1e-07	44.6	mKIAA0846
AK173103	0.00018	27.7	mKIAA1124

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002219 123 137 PR00008 Protein kinase C

IPR002219 139 148 PR00008 Protein kinase C

IPR002219 152 163 PR00008 Protein kinase C

IPR002219 164 176 PR00008 Protein kinase C

IPR000008 265 277 PR00360 C2

IPR000008 289 302 PR00360 C2

IPR000008 310 318 PR00360 C2

HMMPfam IPR002219 126 178 PF00130 Protein kinase C

IPR000008 250 341 PF00168 C2

IPR010439 565 669 PF06292 Protein of unknown function DUF1041

IPR010439 790 882 PF06292 Protein of unknown function DUF1041

HMMSmart IPR002219 126 175 SM00109 Protein kinase C

IPR000008 249 356 SM00239 C2

ProfileScan IPR002219 125 175 PS50081 Protein kinase C

IPR000008 249 341 PS50004 C2

ScanRegExp IPR002219 126 175 PS00479 Protein kinase C

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002219	123	137	PR00008	Protein kinase C
IPR002219	139	148	PR00008	Protein kinase C
IPR002219	152	163	PR00008	Protein kinase C
IPR002219	164	176	PR00008	Protein kinase C
IPR000008	265	277	PR00360	C2
IPR000008	289	302	PR00360	C2
IPR000008	310	318	PR00360	C2
HMMPfam	IPR002219	126	178	PF00130	Protein kinase C
IPR000008	250	341	PF00168	C2
IPR010439	565	669	PF06292	Protein of unknown function DUF1041
IPR010439	790	882	PF06292	Protein of unknown function DUF1041
HMMSmart	IPR002219	126	175	SM00109	Protein kinase C
IPR000008	249	356	SM00239	C2
ProfileScan	IPR002219	125	175	PS50081	Protein kinase C
IPR000008	249	341	PS50004	C2
ScanRegExp	IPR002219	126	175	PS00479	Protein kinase C

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	2510 bp
Genome contig ID	gi65493515f_42993026
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- ATTATAGGGTAGACTTTAATAAATTATCTTATAGC
Flanking genome sequence (187769 - 187818)	----+--------+--------+--------+--------+----* AGCTTTTGGAGTCTGGAATTCTGTGAATATGTGAAAACTATAAAAATGTC

Gene/Protein Characteristic Table for mKIAA4254

Features of the cloned DNA sequence

Features of the protein sequence