ROUGE |
Gene/Protein Characteristic Table for mKIAA4254 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122422 |
---|---|
mbg00605 [Vector Info] | |
Source : | Mouse brain |
Note : | The gene name of mbg00605 was changed from mKIAA1032 to mKIAA4254, because this gene is not a mouse ortholog of KIAA1032 |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6874 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 2510 bp Genome contig ID gi65493515f_42993026 PolyA signal sequence
(AATAAA,-18) +----*----+----*----+----*----+----
ATTATAGGGTAGACTTTAATAAATTATCTTATAGCFlanking genome sequence
(187769 - 187818) ----+----*----+----*----+----*----+----*----+----*
AGCTTTTGGAGTCTGGAATTCTGTGAATATGTGAAAACTATAAAAATGTC
Features of the protein sequence |
Description | |
Coding region: 1563..4361
Length: 933 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |