Gene/Protein Characteristic Table for mKIAA0277

Length: 5506 bp

Restriction map

Length of 3'UTR	3654 bp
Genome contig ID	gi65532617f_113353196
PolyA signal sequence (AATATA,-22)	+----*----+----*----+----*----+---- ATCTGCTTTTCCAAATATAAGACTATGTTAAAGAT
Flanking genome sequence (170902 - 170951)	----+----*----+----*----+----*----+----*----+----* ACCGCTCCTGCCTAGACTCTTCTGTCCTGTGCCACAGTGGCATCCATGGG

KIAA	Alignment based on:
KIAA0277	DNA sequence, AA sequence, Physical map

Coding region: 98..1852

Length: 584 aa

Entry Exp ID% Protein Source AAH46627 0 99.8 Rapgef5 protein... Mus musculus P83900 0 98.4 Rap guanine nuc... Rattus norvegicus XP_539466 0 95.2 similar to Rap ... Canis lupus fam... Q92565 0 95.0 Rap guanine nuc... Homo sapiens EAW93745 0 93.6 hCG38228, isofo... Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK220281 6.7e-89 46.1 mKIAA4040 AB093228 2.6e-29 36.6 mKIAA0313 AK220459 7.5e-29 37.3 mKIAA4052 AK129123 6.4e-12 27.6 mKIAA0351 AK173041 8.6e-10 26.1 mKIAA0846

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000651	69	131	PF00618	Guanine nucleotide exchange factor for Ras-like GTPases
	IPR001895	345	529	PF00617	Guanine-nucleotide dissociation stimulator CDC25
HMMSmart	IPR000651	70	204	SM00229	Guanine nucleotide exchange factor for Ras-like GTPases
	IPR001895	344	584	SM00147	Guanine-nucleotide dissociation stimulator CDC25
ProfileScan	IPR000651	60	129	PS50212	Guanine nucleotide exchange factor for Ras-like GTPases
	IPR001895	347	583	PS50009	Guanine-nucleotide dissociation stimulator CDC25
ScanRegExp	IPR001895	497	526	PS00720	Guanine-nucleotide dissociation stimulator CDC25

Method	From	To	amino acid sequence
-	-	-	-