ROUGE

Gene/Protein Characteristic Table for mKIAA0835

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AB093267
Description :	myelin transcription factor 1. neural zinc finger protein NZF-2b. neural zinc finger transcription factor 2.
Clone Name :	mfj01048 [Vector Info]
Source :	Mouse fetal brain
Note :	We replaced meh02611, former representative clones for mKIAA0835 with mfj01048. (2004/6/22)

Features of the cloned DNA sequence	Description

Length: 5119 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1728 bp

Genome contig ID gi66880554f_181399496
PolyA signal sequence
(AATAAA,-25)
+----*----+----*----+----*----+----
GGTGATTTCTAATAAAAGTCTCACTGTGCATAGGT
Flanking genome sequence
(145235 - 145284)
----+----*----+----*----+----*----+----*----+----*
GCTATGGTCTGTGAGGAGGCTGCTACTCTGATCCTTATGTTTCTGGGAGT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0835 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0835	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..3391
Length: 1129 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
CAM20799	0	100.0	myelin transcri...	Mus musculus
XP_001495632	0	82.9	similar to Myel...	Equus caballus
EDL07461	9.8e-185	96.2	myelin transcri...	Mus musculus
EDL07462	1e-184	96.5	myelin transcri...	Mus musculus
Q8CFC2	1.1e-184	96.6	Myelin transcri...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK122303	6e-52	42.8	mKIAA0535
AB093283	3.5e-51	46.1	mKIAA1106

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR002515 67 97 PF01530 Zinc finger

IPR002515 481 511 PF01530 Zinc finger

IPR002515 525 554 PF01530 Zinc finger

IPR002515 801 831 PF01530 Zinc finger

IPR002515 845 875 PF01530 Zinc finger

IPR002515 894 924 PF01530 Zinc finger

IPR002515 947 977 PF01530 Zinc finger

ProfileScan NULL 250 347 PS50313 NULL

NULL 689 727 PS50324 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002515	67	97	PF01530	Zinc finger
IPR002515	481	511	PF01530	Zinc finger
IPR002515	525	554	PF01530	Zinc finger
IPR002515	801	831	PF01530	Zinc finger
IPR002515	845	875	PF01530	Zinc finger
IPR002515	894	924	PF01530	Zinc finger
IPR002515	947	977	PF01530	Zinc finger
ProfileScan	NULL	250	347	PS50313	NULL
NULL	689	727	PS50324	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1728 bp
Genome contig ID	gi66880554f_181399496
PolyA signal sequence (AATAAA,-25)	+--------+--------+----*----+---- GGTGATTTCTAATAAAAGTCTCACTGTGCATAGGT
Flanking genome sequence (145235 - 145284)	----+--------+--------+--------+--------+----* GCTATGGTCTGTGAGGAGGCTGCTACTCTGATCCTTATGTTTCTGGGAGT

Gene/Protein Characteristic Table for mKIAA0835

Features of the cloned DNA sequence

Features of the protein sequence