ROUGE |
Gene/Protein Characteristic Table for mKIAA0535 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122303 |
---|---|
suppression of tumorigenicity 18. breast carcinoma. |
|
mbg03667 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5654 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 2334 bp Genome contig ID gi65488608f_6353128 PolyA signal sequence
(AATAAA,-17) +----*----+----*----+----*----+----
ATTTGGTGTATGGTAGGAAATAAAAATTGATAATGFlanking genome sequence
(473406 - 473455) ----+----*----+----*----+----*----+----*----+----*
AATTTGGCCATGATATTTACTTTATCAAGACAGATGTCACCAACCCCATG
KIAA Alignment based on: KIAA0535 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 171..3320
Length: 1049 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR002515 | 367 | 397 | PF01530 | Zinc finger |
IPR002515 | 411 | 441 | PF01530 | Zinc finger | |
IPR002515 | 723 | 753 | PF01530 | Zinc finger | |
IPR002515 | 767 | 797 | PF01530 | Zinc finger | |
IPR002515 | 815 | 845 | PF01530 | Zinc finger | |
IPR002515 | 868 | 898 | PF01530 | Zinc finger |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |