| ROUGE |
Gene/Protein Characteristic Table for mKIAA1106 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AB093283 |
|---|---|
| myelin transcription factor 1-like. neural zinc finger transcription factor 1. postmeiotic neural gene 1. |
|
| mbg00011 [Vector Info] | |
| Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 4194 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 371 bp Genome contig ID gi65532617f_26195696 PolyA signal sequence
(None) +----*----+----*----+----*----+----
GTTTTAGTATTTTGAACTGAAATGGACAAAAAAAGFlanking genome sequence
(295528 - 295577) ----+----*----+----*----+----*----+----*----+----*
AAAAAGGAAAAAAAAAGCAGGTTTGAACGATCACTTTGTGGCCTCCTGGC
KIAA Alignment based on: KIAA1106 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 188..3823
Length: 1211 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage
| |