ROUGE

Gene/Protein Characteristic Table for mKIAA0704

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173006
Description :	Oxysterol binding protein-related protein 3.
Clone Name :	mbg11653 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 6399 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 4794 bp

Genome contig ID gi65504368r_50344747
PolyA signal sequence
(None)
+----*----+----*----+----*----+----
AAAACCAGGTGAAAATACCATTTCTTAGACTGGCC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAAAAAAAAAAAAAAAAAAAAAAAAAGATGGCTGGTAACAGCATGCTATA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0704 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0704	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 295..1545, 4468..5196, 5199..5693
Length: 824 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
XP_342684	94.6	similar to Oxys...	Rattus norvegicus
AAC26986	88.1	unknown [Homo s...	Homo sapiens
XP_001160186	89.1	oxysterol-bindi...	Pan troglodytes
Q9H4L5	89.1	Oxysterol-bindi...	Homo sapiens
XP_539480	88.6	similar to oxys...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220498	6.1e-41	52.8	mKIAA4128
AK220301	3.6e-17	35.9	mKIAA4220
AK220257	1.6e-09	28.3	mKIAA0772
AK129385	0.00015	22.0	mKIAA1534

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001849 83 177 PF00169 Pleckstrin-like

IPR000648 517 824 PF01237 Oxysterol-binding protein

HMMSmart IPR001849 83 179 SM00233 Pleckstrin-like

ProfileScan IPR001849 82 177 PS50003 Pleckstrin-like

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	83	177	PF00169	Pleckstrin-like
IPR000648	517	824	PF01237	Oxysterol-binding protein
HMMSmart	IPR001849	83	179	SM00233	Pleckstrin-like
ProfileScan	IPR001849	82	177	PS50003	Pleckstrin-like

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	4794 bp
Genome contig ID	gi65504368r_50344747
PolyA signal sequence (None)	+--------+--------+----*----+---- AAAACCAGGTGAAAATACCATTTCTTAGACTGGCC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAAAAAAAAAAAAAAAAAAAAAAAAAGATGGCTGGTAACAGCATGCTATA

Gene/Protein Characteristic Table for mKIAA0704

Features of the cloned DNA sequence

Features of the protein sequence