ROUGE |
Gene/Protein Characteristic Table for mKIAA0769 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122368 |
---|---|
FCH and double SH3 domains 2. SH3 multiple domains 3. |
|
mbh03536 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4296 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 1865 bp Genome contig ID gi65511124f_95115465 PolyA signal sequence
(AATAAA,-16) +----*----+----*----+----*----+----
TATGTATAAAATGTTGAATAATAAAAAATGAAATTFlanking genome sequence
(275490 - 275539) ----+----*----+----*----+----*----+----*----+----*
AAGTTTTGCAAGTGTCCTGATAAAGAGTTGATTAGGCAGGCTTTGAGAGA
KIAA Alignment based on: KIAA0769 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 122..2431
Length: 769 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |