ROUGE |
Gene/Protein Characteristic Table for mFLJ00007 |
Link to : NEDO | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | BC057367 |
---|---|
FCH and double SH3 domains 1. | |
mfj33016 [Vector Info] | |
Source : | Mouse fetal brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4223 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2157 bp Genome contig ID gi65551972r_38081155 PolyA signal sequence
(AATAAA,-23) +----*----+----*----+----*----+----
CCCTTTGCCTGTAATAAATTCACTGTTAAGCCATGFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AGTGGTCATGTGTTCGTCCTTTCCACCCTGCTTACTAAAGAGAGCAATGC
KIAA Alignment based on: FLJ00007 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..2066
Length: 687 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001452 | 472 | 521 | PD000066 | SH3 |
IPR001452 | 549 | 596 | PD000066 | SH3 | |
FPrintScan | IPR001452 | 546 | 556 | PR00452 | SH3 |
IPR001452 | 560 | 575 | PR00452 | SH3 | |
IPR001452 | 592 | 604 | PR00452 | SH3 | |
HMMPfam | IPR001060 | 15 | 104 | PF00611 | Cdc15/Fes/CIP4 |
IPR001452 | 468 | 524 | PF00018 | SH3 | |
IPR011511 | 469 | 523 | PF07653 | Variant SH3 | |
IPR001452 | 546 | 604 | PF00018 | SH3 | |
IPR011511 | 547 | 604 | PF07653 | Variant SH3 | |
HMMSmart | IPR001060 | 15 | 104 | SM00055 | Cdc15/Fes/CIP4 |
IPR001452 | 468 | 525 | SM00326 | SH3 | |
IPR001452 | 546 | 605 | SM00326 | SH3 | |
ProfileScan | IPR001060 | 11 | 74 | PS50133 | Cdc15/Fes/CIP4 |
IPR001452 | 472 | 526 | PS50002 | SH3 | |
IPR001452 | 543 | 606 | PS50002 | SH3 | |
IPR000694 | 607 | 685 | PS50099 | Proline-rich region |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |