ROUGE |
Gene/Protein Characteristic Table for mKIAA0718 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK122355 |
---|---|
diacylglycerol kinase, beta. | |
mbg07395 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5875 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 3563 bp Genome contig ID gi65532617f_34585238 PolyA signal sequence
(AATAAA,-31) +----*----+----*----+----*----+----
TTGAAATAAAAGTGTTTGTCATTCACTTGTGCATCFlanking genome sequence
(652421 - 652470) ----+----*----+----*----+----*----+----*----+----*
ATTTATCTTGTACCAAATGCTCCTTTCATGTGAAATATCTATGAGAACAT
KIAA Alignment based on: KIAA0718 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 3..2312
Length: 769 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |