ROUGE |
Gene/Protein Characteristic Table for mKIAA0145 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK172901 |
---|---|
mbg16251 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5139 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 2017 bp Genome contig ID gi65488608f_87634631 PolyA signal sequence
(AATAAA,-28) +----*----+----*----+----*----+----
TGTGTATAATAAAACAGGCCTGTTTTTGATCTTCCFlanking genome sequence
(128986 - 129035) ----+----*----+----*----+----*----+----*----+----*
AGTGAGCATTCCTGTCCTCATTTCTGTGCTGACAGTTGCTAGCGGTTCTG
KIAA Alignment based on: KIAA0145 DNA sequence
Features of the protein sequence |
Description | |
Coding region: 3..3122
Length: 1039 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR001206 | 193 | 237 | PD005043 | Diacylglycerol kinase |
IPR001206 | 580 | 696 | PD005043 | Diacylglycerol kinase | |
IPR000756 | 697 | 762 | PD002939 | Diacylglycerol kinase accessory region | |
HMMPfam | IPR002219 | 55 | 108 | PF00130 | Protein kinase C |
IPR001206 | 140 | 265 | PF00781 | Diacylglycerol kinase | |
IPR000756 | 584 | 741 | PF00609 | Diacylglycerol kinase accessory region | |
IPR011510 | 967 | 1033 | PF07647 | Sterile alpha motif homology 2 | |
IPR001660 | 968 | 1031 | PF00536 | Sterile alpha motif SAM | |
HMMSmart | IPR002219 | 1 | 32 | SM00109 | Protein kinase C |
IPR002219 | 55 | 105 | SM00109 | Protein kinase C | |
IPR001206 | 140 | 265 | SM00046 | Diacylglycerol kinase | |
IPR000756 | 584 | 741 | SM00045 | Diacylglycerol kinase accessory region | |
IPR001660 | 967 | 1033 | SM00454 | Sterile alpha motif SAM | |
ProfileScan | IPR002219 | 1 | 32 | PS50081 | Protein kinase C |
IPR002219 | 54 | 105 | PS50081 | Protein kinase C | |
IPR001206 | 140 | 675 | PS50146 | Diacylglycerol kinase | |
IPR001660 | 970 | 1033 | PS50105 | Sterile alpha motif SAM | |
ScanRegExp | IPR002219 | 55 | 105 | PS00479 | Protein kinase C |
Method | From | To | amino acid sequence |
---|---|---|---|
- | - | - | - |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |