Gene/Protein Characteristic Table for mKIAA0145

Length: 5139 bp

Restriction map

Length of 3'UTR	2017 bp
Genome contig ID	gi65488608f_87634631
PolyA signal sequence (AATAAA,-28)	+----*----+----*----+----*----+---- TGTGTATAATAAAACAGGCCTGTTTTTGATCTTCC
Flanking genome sequence (128986 - 129035)	----+----*----+----*----+----*----+----*----+----* AGTGAGCATTCCTGTCCTCATTTCTGTGCTGACAGTTGCTAGCGGTTCTG

KIAA	Alignment based on:
KIAA0145	DNA sequence

Coding region: 3..3122

Length: 1039 aa

Entry Exp ID% Protein Source EDL40135 0 100.0 mCG131116, isof... Mus musculus NP_808314 0 100.0 diacylglycerol ... Mus musculus EDL92145 0 98.0 similar to diac... Rattus norvegicus XP_001065445 0 98.2 similar to diac... Rattus norvegicus XP_347259 0 98.2 similar to diac... Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK220294 1.8e-22 40.1 mKIAA4131 AK122355 2.5e-18 36.4 mKIAA0718 AK220363 1.5e-05 50.8 mKIAA1022 AK173228 0.00058 39.7 mKIAA1650

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001206	193	237	PD005043	Diacylglycerol kinase
	IPR001206	580	696	PD005043	Diacylglycerol kinase
	IPR000756	697	762	PD002939	Diacylglycerol kinase accessory region
HMMPfam	IPR002219	55	108	PF00130	Protein kinase C
	IPR001206	140	265	PF00781	Diacylglycerol kinase
	IPR000756	584	741	PF00609	Diacylglycerol kinase accessory region
	IPR011510	967	1033	PF07647	Sterile alpha motif homology 2
	IPR001660	968	1031	PF00536	Sterile alpha motif SAM
HMMSmart	IPR002219	1	32	SM00109	Protein kinase C
	IPR002219	55	105	SM00109	Protein kinase C
	IPR001206	140	265	SM00046	Diacylglycerol kinase
	IPR000756	584	741	SM00045	Diacylglycerol kinase accessory region
	IPR001660	967	1033	SM00454	Sterile alpha motif SAM
ProfileScan	IPR002219	1	32	PS50081	Protein kinase C
	IPR002219	54	105	PS50081	Protein kinase C
	IPR001206	140	675	PS50146	Diacylglycerol kinase
	IPR001660	970	1033	PS50105	Sterile alpha motif SAM
ScanRegExp	IPR002219	55	105	PS00479	Protein kinase C

Method	From	To	amino acid sequence
-	-	-	-