Order Kazusa clone(s) from : ![]() |
Product ID | ORK04763 |
---|---|
Accession No | AB018261 |
Description | diacylglycerol kinase, beta 90kDa |
Clone name | hk01073 |
Vector information | |
cDNA sequence | DNA sequence (3742 bp) Predicted protein sequence (742 aa) |
Source | Human adult brain |
Rouge ID |
mKIAA0718
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | Warning | No warning |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
BlastProDom | IPR002048 | 92 | 156 | PD000012 | Calcium-binding EF-hand |
IPR001206 | 368 | 471 | PD005043 | Diacylglycerol kinase | |
IPR000756 | 677 | 719 | PD002939 | Diacylglycerol kinase accessory region | |
FPrintScan | IPR002219 | 180 | 194 | PR00008 | Protein kinase C |
IPR002219 | 196 | 205 | PR00008 | Protein kinase C | |
IPR002219 | 209 | 220 | PR00008 | Protein kinase C | |
IPR002219 | 221 | 233 | PR00008 | Protein kinase C | |
HMMPfam | IPR002048 | 91 | 119 | PF00036 | Calcium-binding EF-hand |
IPR002048 | 136 | 164 | PF00036 | Calcium-binding EF-hand | |
IPR002219 | 183 | 235 | PF00130 | Protein kinase C | |
IPR002219 | 248 | 299 | PF00130 | Protein kinase C | |
IPR001206 | 376 | 500 | PF00781 | Diacylglycerol kinase | |
IPR000756 | 520 | 700 | PF00609 | Diacylglycerol kinase accessory region | |
HMMSmart | IPR002048 | 91 | 119 | SM00054 | Calcium-binding EF-hand |
IPR002048 | 136 | 164 | SM00054 | Calcium-binding EF-hand | |
IPR002219 | 181 | 232 | SM00109 | Protein kinase C | |
IPR002219 | 248 | 296 | SM00109 | Protein kinase C | |
IPR001206 | 376 | 500 | SM00046 | Diacylglycerol kinase | |
IPR000756 | 520 | 700 | SM00045 | Diacylglycerol kinase accessory region | |
ProfileScan | IPR002048 | 87 | 122 | PS50222 | Calcium-binding EF-hand |
IPR002048 | 132 | 167 | PS50222 | Calcium-binding EF-hand | |
IPR002219 | 182 | 232 | PS50081 | Protein kinase C | |
IPR002219 | 247 | 296 | PS50081 | Protein kinase C | |
ScanRegExp | IPR002048 | 100 | 112 | PS00018 | Calcium-binding EF-hand |
IPR002048 | 145 | 157 | PS00018 | Calcium-binding EF-hand | |
IPR002219 | 183 | 232 | PS00479 | Protein kinase C | |
IPR002219 | 247 | 298 | PS00479 | Protein kinase C |
![]() |
Primer_f | ATGCAATTAGCTCCCTCCTCC |
---|---|
Primer_r | AGAGACTCCAACTATGCCATG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | ATGCAATTAGCTCCCTCCTCC |
Primer_r | AGAGACTCCAACTATGCCATG |
PCR product length | 121 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |