ROUGE

Gene/Protein Characteristic Table for mKIAA0693

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK173004
Description :	synovial sarcoma translocation gene on chromosome 18-like 1.
Clone Name :	mfj10262 [Vector Info]
Source :	Mouse fetal brain

Features of the cloned DNA sequence	Description

Length: 4121 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2842 bp

Genome contig ID gi66880554f_179659689
PolyA signal sequence
(ATTAAA,-23)
+----*----+----*----+----*----+----
CTTTCCATTTCCATTAAAACACTTTTTTAGCCATT
Flanking genome sequence
(127472 - 127521)
----+----*----+----*----+----*----+----*----+----*
ACCTCATTTCTGTTTATTGAGCATGTTACGTCTGTCTTGTTATTTGTGAA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0693 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0693	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 56..1279
Length: 407 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
BAC35824	4.5e-130	100.0	unnamed protein...	Mus musculus
BAC30089	7.1e-130	99.8	unnamed protein...	Mus musculus
AAH54730	1.1e-129	99.8	Synovial sarcom...	Mus musculus
EDL88832	2.5e-129	99.3	synovial sarcom...	Rattus norvegicus
EDL07307	4.5e-127	100.0	synovial sarcom...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
BC065062	2e-25	56.8	mKIAA4121

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007726 16 81 PF05030 SSXT

ProfileScan NULL 202 407 PS50322 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007726	16	81	PF05030	SSXT
ProfileScan	NULL	202	407	PS50322	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2842 bp
Genome contig ID	gi66880554f_179659689
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- CTTTCCATTTCCATTAAAACACTTTTTTAGCCATT
Flanking genome sequence (127472 - 127521)	----+--------+--------+--------+--------+----* ACCTCATTTCTGTTTATTGAGCATGTTACGTCTGTCTTGTTATTTGTGAA

Gene/Protein Characteristic Table for mKIAA0693

Features of the cloned DNA sequence

Features of the protein sequence