ROUGE

Gene/Protein Characteristic Table for mKIAA4121

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	BC065062
Description :	SSXT protein.
Clone Name :	mph01062 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 2830 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1654 bp

Genome contig ID gi65551972r_14713893
PolyA signal sequence
(AATAAA,-20)
+----*----+----*----+----*----+----
CAACTCTAACGAAAGAATAAATTATTTGTGATTTT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AATTTTCTCATTTGTTTCTTTAAATTAGATCTCTTTGACTCTTACTGTTT

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 1..1173
Length: 391 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH65062	6.1e-117	100.0	Ss18 protein [M...	Mus musculus
BAC38970	9.5e-116	100.0	unnamed protein...	Mus musculus
AAH83824	1.3e-115	98.5	Ss18 protein [R...	Rattus norvegicus
AAL17747	1.4e-115	99.7	synovial sarcom...	Mus musculus
CAA55792	2.7e-113	95.7	SYT [Homo sapiens].	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173004	6.7e-18	57.3	mKIAA0693
AK131153	0.00083	29.8	mFLJ00201

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR007726 15 80 PF05030 SSXT

ProfileScan IPR000694 80 378 PS50099 Proline-rich region

NULL 87 254 PS50320 NULL

NULL 175 391 PS50322 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR007726	15	80	PF05030	SSXT
ProfileScan	IPR000694	80	378	PS50099	Proline-rich region
NULL	87	254	PS50320	NULL
NULL	175	391	PS50322	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1654 bp
Genome contig ID	gi65551972r_14713893
PolyA signal sequence (AATAAA,-20)	+--------+--------+----*----+---- CAACTCTAACGAAAGAATAAATTATTTGTGATTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AATTTTCTCATTTGTTTCTTTAAATTAGATCTCTTTGACTCTTACTGTTT

Gene/Protein Characteristic Table for mKIAA4121

Features of the cloned DNA sequence

Features of the protein sequence