ROUGE |
Gene/Protein Characteristic Table for mKIAA1445 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129362 |
---|---|
Semaphorin 5B precursor. | |
mph02187 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 2878 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 978 bp Genome contig ID gi65546577f_34335033 PolyA signal sequence
(ATTAAA,-23) +----*----+----*----+----*----+----
GTGGCATTATTAATTAAAGATGATATCCAGTCTCCFlanking genome sequence
(112589 - 112638) ----+----*----+----*----+----*----+----*----+----*
AAATGGAACTGTCTTTGTGCATATGTGTGTGGACCCTCTTGGCATGGTGT
KIAA Alignment based on: KIAA1445 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..1900
Length: 632 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
HMMPfam | IPR002165 | 36 | 83 | PF01437 | Plexin |
IPR000884 | 149 | 200 | PF00090 | Thrombospondin | |
IPR000884 | 207 | 251 | PF00090 | Thrombospondin | |
IPR000884 | 338 | 388 | PF00090 | Thrombospondin | |
IPR000884 | 395 | 445 | PF00090 | Thrombospondin | |
IPR000884 | 450 | 490 | PF00090 | Thrombospondin | |
HMMSmart | IPR003659 | 36 | 83 | SM00423 | Plexin/semaphorin/integrin |
IPR000884 | 93 | 147 | SM00209 | Thrombospondin | |
IPR000884 | 148 | 201 | SM00209 | Thrombospondin | |
IPR000884 | 206 | 252 | SM00209 | Thrombospondin | |
IPR000884 | 337 | 389 | SM00209 | Thrombospondin | |
IPR000884 | 394 | 446 | SM00209 | Thrombospondin | |
IPR000884 | 449 | 496 | SM00209 | Thrombospondin | |
ProfileScan | IPR000884 | 90 | 149 | PS50092 | Thrombospondin |
IPR000884 | 145 | 202 | PS50092 | Thrombospondin | |
IPR000884 | 203 | 253 | PS50092 | Thrombospondin | |
IPR000884 | 334 | 390 | PS50092 | Thrombospondin | |
IPR000884 | 391 | 447 | PS50092 | Thrombospondin | |
IPR000884 | 446 | 497 | PS50092 | Thrombospondin |
Method | From | To | amino acid sequence |
---|---|---|---|
SOSUI | 515 | 537 | LIHLIVTGVSCFLVSGLLTLAVY |
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |