Gene/Protein Characteristic Table for mKIAA1445

Length: 2878 bp

Restriction map

Length of 3'UTR	978 bp
Genome contig ID	gi65546577f_34335033
PolyA signal sequence (ATTAAA,-23)	+----*----+----*----+----*----+---- GTGGCATTATTAATTAAAGATGATATCCAGTCTCC
Flanking genome sequence (112589 - 112638)	----+----*----+----*----+----*----+----*----+----* AAATGGAACTGTCTTTGTGCATATGTGTGTGGACCCTCTTGGCATGGTGT

KIAA	Alignment based on:
KIAA1445	DNA sequence, AA sequence, Physical map

Coding region: 2..1900

Length: 632 aa

Entry Exp ID% Protein Source EDK97889 0 100.0 sema domain, se... Mus musculus Q60519 0 99.8 Semaphorin-5B; ... Mus musculus EDM11312 0 97.6 sema domain, se... Rattus norvegicus XP_001500249 0 92.6 similar to Sema... Equus caballus AAH77726 0 92.7 Sema domain, se... Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK129162 2.6e-18 30.5 mKIAA0550 AK220481 4.2e-18 29.5 mKIAA4089 BC063250 5.3e-10 27.9 mKIAA1679 AK173338 2.9e-08 28.1 mKIAA2029 AK173001 1.2e-07 34.7 mKIAA0688

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR002165	36	83	PF01437	Plexin
	IPR000884	149	200	PF00090	Thrombospondin
	IPR000884	207	251	PF00090	Thrombospondin
	IPR000884	338	388	PF00090	Thrombospondin
	IPR000884	395	445	PF00090	Thrombospondin
	IPR000884	450	490	PF00090	Thrombospondin
HMMSmart	IPR003659	36	83	SM00423	Plexin/semaphorin/integrin
	IPR000884	93	147	SM00209	Thrombospondin
	IPR000884	148	201	SM00209	Thrombospondin
	IPR000884	206	252	SM00209	Thrombospondin
	IPR000884	337	389	SM00209	Thrombospondin
	IPR000884	394	446	SM00209	Thrombospondin
	IPR000884	449	496	SM00209	Thrombospondin
ProfileScan	IPR000884	90	149	PS50092	Thrombospondin
	IPR000884	145	202	PS50092	Thrombospondin
	IPR000884	203	253	PS50092	Thrombospondin
	IPR000884	334	390	PS50092	Thrombospondin
	IPR000884	391	447	PS50092	Thrombospondin
	IPR000884	446	497	PS50092	Thrombospondin

Method	From	To	amino acid sequence
SOSUI	515	537	LIHLIVTGVSCFLVSGLLTLAVY