ROUGE

Gene/Protein Characteristic Table for mKIAA0021

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122188
Description :	a disintegrin and metalloprotease domain 9 (meltrin gamma). meltrin gamma.
Clone Name :	mbh01716 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 3945 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 1283 bp

Genome contig ID gi65515060r_23572261
PolyA signal sequence
(AATAAA,-18)
+----*----+----*----+----*----+----
GTATATATACATATTAAAATAAAAACATTTACAAC
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AAATAAAATACTTGAAATTCTTGTTTTGTCGTCCTCTTTATAAATACATA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0021 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0021	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 101..2662
Length: 853 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q61072	100.0	ADAM 9; A disin...	Mus musculus
NP_031430	99.9	a disintegrin a...	Mus musculus
AAX55228	95.7	ADAM9 [Rattus n...	Rattus norvegicus
EDL32849	96.5	a disintegrin a...	Mus musculus
BAE33380	99.9	unnamed protein...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220274	5.2e-16	39.6	mKIAA4001
BC050834	8.2e-05	25.4	mKIAA1346
AK173338	0.00015	24.3	mKIAA2029

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001762 463 503 PD000664 Disintegrin

FPrintScan IPR001762 463 482 PR00289 Disintegrin

IPR001762 492 504 PR00289 Disintegrin

HMMPfam IPR002870 88 203 PF01562 Peptidase M12B

IPR001590 220 414 PF01421 Peptidase M12B

IPR001762 431 507 PF00200 Disintegrin

NULL 652 681 PF07974 NULL

HMMSmart IPR001762 431 507 SM00050 Disintegrin

ProfileScan IPR001590 220 414 PS50215 Peptidase M12B

IPR001762 422 509 PS50214 Disintegrin

NULL 436 532 PS50311 NULL

IPR000694 755 847 PS50099 Proline-rich region

ScanRegExp IPR006025 352 361 PS00142 Peptidase M

IPR006209 670 681 PS01186 EGF-like

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001762	463	503	PD000664	Disintegrin
FPrintScan	IPR001762	463	482	PR00289	Disintegrin
IPR001762	492	504	PR00289	Disintegrin
HMMPfam	IPR002870	88	203	PF01562	Peptidase M12B
IPR001590	220	414	PF01421	Peptidase M12B
IPR001762	431	507	PF00200	Disintegrin
NULL	652	681	PF07974	NULL
HMMSmart	IPR001762	431	507	SM00050	Disintegrin
ProfileScan	IPR001590	220	414	PS50215	Peptidase M12B
IPR001762	422	509	PS50214	Disintegrin
NULL	436	532	PS50311	NULL
IPR000694	755	847	PS50099	Proline-rich region
ScanRegExp	IPR006025	352	361	PS00142	Peptidase M
IPR006209	670	681	PS01186	EGF-like

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 17 39 LASLRLRWLLACGLLGPVLEAGR

705 726 DGLLVFFFLIVPLVAAAIFLFI

Method	From	To	amino acid sequence
SOSUI	17	39	LASLRLRWLLACGLLGPVLEAGR
705	726	DGLLVFFFLIVPLVAAAIFLFI

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	1283 bp
Genome contig ID	gi65515060r_23572261
PolyA signal sequence (AATAAA,-18)	+--------+--------+----*----+---- GTATATATACATATTAAAATAAAAACATTTACAAC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AAATAAAATACTTGAAATTCTTGTTTTGTCGTCCTCTTTATAAATACATA

Gene/Protein Characteristic Table for mKIAA0021

Features of the cloned DNA sequence

Features of the protein sequence