Gene/Protein Characteristic Table for mKIAA1424

Length: 5536 bp

Restriction map

Length of 3'UTR	3309 bp
Genome contig ID	gi66880554r_20789252
PolyA signal sequence (AATAAA,-22)	+----*----+----*----+----*----+---- TAAATAATACTTAAATAAACTATGCACATTTTAGG
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* ATTTGATGACCTCGGGAGTCACTGGGGCCAGAGATTCACAATGCTGCTGT

KIAA	Alignment based on:
KIAA1424	DNA sequence, AA sequence, Physical map

Coding region: 2..2083, 2359..4065

Length: 1262 aa

Entry Exp ID% Protein Source CAX15781 0 100.0 Rho GTPase acti... Mus musculus CAM13451 0 100.0 Rho GTPase acti... Mus musculus CAX15782 0 100.0 Rho GTPase acti... Mus musculus Q6DFV3 0 99.9 Rho GTPase-acti... Mus musculus AAI50742 0 99.8 Arhgap21 protei... Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK173187 5.1e-42 39.2 mKIAA1501 AK129482 2.1e-10 34.6 mKIAA3017 AK173242 2.1e-09 27.2 mKIAA1722 AK122276 4.9e-09 32.2 mKIAA0411 AK129176 1.7e-08 31.7 mKIAA0621

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001849	243	351	PF00169	Pleckstrin-like
	IPR000198	473	626	PF00620	RhoGAP
HMMSmart	IPR001849	243	353	SM00233	Pleckstrin-like
	IPR000198	470	647	SM00324	RhoGAP
ProfileScan	IPR001849	242	351	PS50003	Pleckstrin-like
	IPR000198	473	619	PS50238	RhoGAP

Method	From	To	amino acid sequence
-	-	-	-