ROUGE |
Gene/Protein Characteristic Table for mKIAA4097 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220486 |
---|---|
ARF-GAP, RHO-GAP, ankyrin repeat and pleckstrin homology domains-containing protein 3. dual-specificity Rho- and Arf-GTPase activating protein 1. ARF-GAP, RHO-GAP, ankyrin repeat and plekstrin homology domains-containing protein 3. |
|
mbg03907 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5173 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 296 bp Genome contig ID gi65551972r_38096356 PolyA signal sequence
(AATAAA,-16) +----*----+----*----+----*----+----
AGAGGAATGGATCACTATTAATAAAATTTGGAACCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAAAGGCTCATTCTTTTTAGCATCATTCATTCATTCATTCATTCATTCAA
Features of the protein sequence |
Description | |
Coding region: 1776..4874
Length: 1033 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |