| ROUGE |
Gene/Protein Characteristic Table for mKIAA0550 |
| Link to : HUGE | InGAP | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK129162 |
|---|---|
| Brain-specific angiogenesis inhibitor 3 precursor. | |
| mbg18962 [Vector Info] | |
| Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5279 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 3439 bp Genome contig ID gi65488608r_25632693 PolyA signal sequence
(None)
TATTATTTTAAATGGCTTGAAATGATGACATGACCFlanking genome sequence
(100000 - 99951)
AAAAAAAAAAATGATTTGATGTGTTAAAAAAGAGTATGACCATCACCTAT
KIAA Alignment based on: KIAA0550 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..1840
Length: 612 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
| Search method | interpro_ID | From | To | Entry | Definition |
|---|---|---|---|---|---|
| HMMPfam | IPR000884 | 157 | 204 | PF00090 | Thrombospondin |
| IPR000884 | 211 | 259 | PF00090 | Thrombospondin | |
| IPR000884 | 266 | 314 | PF00090 | Thrombospondin | |
| IPR000884 | 321 | 369 | PF00090 | Thrombospondin | |
| IPR001879 | 373 | 434 | PF02793 | Hormone receptor | |
| HMMSmart | IPR000884 | 156 | 205 | SM00209 | Thrombospondin |
| IPR000884 | 210 | 260 | SM00209 | Thrombospondin | |
| IPR000884 | 265 | 315 | SM00209 | Thrombospondin | |
| IPR000884 | 320 | 370 | SM00209 | Thrombospondin | |
| IPR001879 | 372 | 438 | SM00008 | Hormone receptor | |
| ProfileScan | IPR000884 | 153 | 206 | PS50092 | Thrombospondin |
| IPR000884 | 207 | 261 | PS50092 | Thrombospondin | |
| IPR000884 | 262 | 316 | PS50092 | Thrombospondin | |
| IPR000884 | 317 | 371 | PS50092 | Thrombospondin | |
| IPR001879 | 353 | 433 | PS50227 | Hormone receptor |
| Method | From | To | amino acid sequence |
|---|---|---|---|
| - | - | - | - |
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage 
| |
