| ROUGE |
Gene/Protein Characteristic Table for mKIAA0762 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK173021 |
|---|---|
| spondin 1, (f-spondin) extracellular matrix protein. | |
| mbg11441 [Vector Info] | |
| Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 5573 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 3973 bp Genome contig ID gi65511124f_107518917 PolyA signal sequence
(None)
TGTATTTTCCTTAACACACGAGAGCCTGTTCAATTFlanking genome sequence
(375280 - 375329)
AAAAAAAAAAAAAAAAGAAAAGAAAAGAAAATCTCGCTGGGTCTGTCTTT
KIAA Alignment based on: KIAA0762 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..1534, 3634..4290
Length: 729 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage 
| |
