ROUGE

Gene/Protein Characteristic Table for mKIAA0533

Link to : HUGE \| InGAP \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129157
Description :	Laminin alpha-5 chain precursor.
Clone Name :	mpf00729 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 6161 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 173 bp

Genome contig ID gi66880554r_179793333
PolyA signal sequence
(ATTAAA,-18)
+----*----+----*----+----*----+----
CAGTACTGAGATCTGAAATTAAAATGACTTGTTTG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ACTTGAGTGTGTTGATTTATAAACAGCAATGGTGGTGGGGTACAGAGCCC

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0533 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0533	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 1..534, 883..1494, 1709..2719, 2956..5904
Length: 1702 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL07320	88.1	mCG6728, isofor...	Mus musculus
EDL07319	87.9	mCG6728, isofor...	Mus musculus
CAM16215	87.9	laminin, alpha ...	Mus musculus
AAC53430	87.8	laminin alpha 5...	Mus musculus
Q61001	87.8	Laminin subunit...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK131151	2.3e-13	31.8	mFLJ00193
AK173032	4.3e-11	33.7	mKIAA0815
AK122555	2.1e-09	34.6	mKIAA1781
AK220215	4e-09	33.2	mKIAA0149
AK122378	1.2e-07	33.0	mKIAA0818

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR000034 1 27 PD003031 Laminin B

HMMPfam IPR002049 107 154 PF00053 Laminin-type EGF-like

IPR002049 157 195 PF00053 Laminin-type EGF-like

IPR002049 198 242 PF00053 Laminin-type EGF-like

IPR002049 245 292 PF00053 Laminin-type EGF-like

IPR009254 319 543 PF06008 Laminin I

IPR010307 634 775 PF06009 Laminin II

IPR012680 985 1114 PF02210 Laminin G

IPR012680 1168 1285 PF02210 Laminin G

IPR012680 1378 1508 PF02210 Laminin G

IPR012679 1558 1684 PF00054 Laminin G

IPR012680 1558 1681 PF02210 Laminin G

HMMSmart IPR002049 60 104 SM00180 Laminin-type EGF-like

IPR002049 107 154 SM00180 Laminin-type EGF-like

IPR002049 157 195 SM00180 Laminin-type EGF-like

IPR002049 198 242 SM00180 Laminin-type EGF-like

IPR002049 245 292 SM00180 Laminin-type EGF-like

IPR001791 771 923 SM00282 Laminin G

IPR001791 977 1114 SM00282 Laminin G

IPR001791 1160 1285 SM00282 Laminin G

IPR001791 1370 1508 SM00282 Laminin G

IPR001791 1550 1681 SM00282 Laminin G

ProfileScan NULL 74 273 PS50311 NULL

IPR002049 104 150 PS50027 Laminin-type EGF-like

IPR002049 195 242 PS50027 Laminin-type EGF-like

IPR001791 749 944 PS50025 Laminin G

IPR001791 958 1130 PS50025 Laminin G

IPR001791 1139 1307 PS50025 Laminin G

IPR001791 1348 1522 PS50025 Laminin G

IPR001791 1529 1700 PS50025 Laminin G

ScanRegExp IPR006209 74 85 PS00022 EGF-like

IPR002049 74 109 PS01248 Laminin-type EGF-like

IPR002049 123 157 PS01248 Laminin-type EGF-like

IPR001368 179 218 PS00652 TNFR/CD27/30/40/95 cysteine-rich region

IPR006209 198 209 PS00022 EGF-like

IPR006209 216 227 PS00022 EGF-like

IPR002049 216 247 PS01248 Laminin-type EGF-like

IPR006209 259 270 PS00022 EGF-like

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000034	1	27	PD003031	Laminin B
HMMPfam	IPR002049	107	154	PF00053	Laminin-type EGF-like
IPR002049	157	195	PF00053	Laminin-type EGF-like
IPR002049	198	242	PF00053	Laminin-type EGF-like
IPR002049	245	292	PF00053	Laminin-type EGF-like
IPR009254	319	543	PF06008	Laminin I
IPR010307	634	775	PF06009	Laminin II
IPR012680	985	1114	PF02210	Laminin G
IPR012680	1168	1285	PF02210	Laminin G
IPR012680	1378	1508	PF02210	Laminin G
IPR012679	1558	1684	PF00054	Laminin G
IPR012680	1558	1681	PF02210	Laminin G
HMMSmart	IPR002049	60	104	SM00180	Laminin-type EGF-like
IPR002049	107	154	SM00180	Laminin-type EGF-like
IPR002049	157	195	SM00180	Laminin-type EGF-like
IPR002049	198	242	SM00180	Laminin-type EGF-like
IPR002049	245	292	SM00180	Laminin-type EGF-like
IPR001791	771	923	SM00282	Laminin G
IPR001791	977	1114	SM00282	Laminin G
IPR001791	1160	1285	SM00282	Laminin G
IPR001791	1370	1508	SM00282	Laminin G
IPR001791	1550	1681	SM00282	Laminin G
ProfileScan	NULL	74	273	PS50311	NULL
IPR002049	104	150	PS50027	Laminin-type EGF-like
IPR002049	195	242	PS50027	Laminin-type EGF-like
IPR001791	749	944	PS50025	Laminin G
IPR001791	958	1130	PS50025	Laminin G
IPR001791	1139	1307	PS50025	Laminin G
IPR001791	1348	1522	PS50025	Laminin G
IPR001791	1529	1700	PS50025	Laminin G
ScanRegExp	IPR006209	74	85	PS00022	EGF-like
IPR002049	74	109	PS01248	Laminin-type EGF-like
IPR002049	123	157	PS01248	Laminin-type EGF-like
IPR001368	179	218	PS00652	TNFR/CD27/30/40/95 cysteine-rich region
IPR006209	198	209	PS00022	EGF-like
IPR006209	216	227	PS00022	EGF-like
IPR002049	216	247	PS01248	Laminin-type EGF-like
IPR006209	259	270	PS00022	EGF-like

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	173 bp
Genome contig ID	gi66880554r_179793333
PolyA signal sequence (ATTAAA,-18)	+--------+--------+----*----+---- CAGTACTGAGATCTGAAATTAAAATGACTTGTTTG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ACTTGAGTGTGTTGATTTATAAACAGCAATGGTGGTGGGGTACAGAGCCC

Gene/Protein Characteristic Table for mKIAA0533

Features of the cloned DNA sequence

Features of the protein sequence