ROUGE

Gene/Protein Characteristic Table for mKIAA1781

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122555
Description :
Clone Name :	mbg19640 [Vector Info]
Source :	Mouse brain
Note :	We replaced mbg06605, former representative clones for mKIAA1781 with mbg19640. (2004/6/22)

Features of the cloned DNA sequence	Description

Length: 6680 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3255 bp

Genome contig ID gi65519420f_64407878
PolyA signal sequence
(AATAAA,-29)
+----*----+----*----+----*----+----
ATACAAAATAAAATGGATTCTCAAACTAACATTAC
Flanking genome sequence
(423531 - 423580)
----+----*----+----*----+----*----+----*----+----*
AAGAATGCCTACTGTTGTGTTGCAAACTGAAAATCTATACATTTTATGTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA1781 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA1781	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..3425
Length: 1140 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q80T91	100.0	Multiple epider...	Mus musculus
XP_001076145	98.8	similar to MEGF...	Rattus norvegicus
XP_544734	95.5	similar to MEGF...	Canis lupus fam...
AAI72024	100.0	Megf11 protein ...	Mus musculus
XP_001917984	85.9	similar to Mult...	Equus caballus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK173032	4.6e-112	43.4	mKIAA0815
AK220215	1.2e-38	35.8	mKIAA0149
AK131151	7.5e-28	34.6	mFLJ00193
AK220196	1.2e-15	27.1	mKIAA4226
AF290914	3.3e-14	25.5	mKIAA0246

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR002049 245 263 PR00011 Laminin-type EGF-like

IPR002049 809 827 PR00011 Laminin-type EGF-like

IPR002049 852 870 PR00011 Laminin-type EGF-like

HMMPfam IPR011489 72 144 PF07546 EMI

IPR006209 151 177 PF00008 EGF-like

IPR002049 194 233 PF00053 Laminin-type EGF-like

IPR002049 237 276 PF00053 Laminin-type EGF-like

IPR006209 276 306 PF00008 EGF-like

NULL 280 306 PF07974 NULL

IPR002049 323 362 PF00053 Laminin-type EGF-like

IPR002049 366 406 PF00053 Laminin-type EGF-like

NULL 366 392 PF07974 NULL

IPR002049 410 451 PF00053 Laminin-type EGF-like

IPR002049 498 541 PF00053 Laminin-type EGF-like

NULL 498 524 PF07974 NULL

IPR002049 627 670 PF00053 Laminin-type EGF-like

IPR002049 715 754 PF00053 Laminin-type EGF-like

NULL 715 741 PF07974 NULL

NULL 758 784 PF07974 NULL

IPR002049 801 844 PF00053 Laminin-type EGF-like

HMMSmart IPR006210 150 178 SM00181 Type I EGF

IPR002049 157 190 SM00180 Laminin-type EGF-like

IPR006210 189 221 SM00181 Type I EGF

IPR002049 194 233 SM00180 Laminin-type EGF-like

IPR006210 232 264 SM00181 Type I EGF

IPR002049 237 276 SM00180 Laminin-type EGF-like

IPR006210 275 307 SM00181 Type I EGF

IPR002049 280 319 SM00180 Laminin-type EGF-like

IPR006210 318 350 SM00181 Type I EGF

IPR002049 323 362 SM00180 Laminin-type EGF-like

IPR006210 361 393 SM00181 Type I EGF

IPR002049 366 406 SM00180 Laminin-type EGF-like

IPR006210 405 439 SM00181 Type I EGF

IPR002049 410 451 SM00180 Laminin-type EGF-like

IPR006210 450 482 SM00181 Type I EGF

IPR002049 455 494 SM00180 Laminin-type EGF-like

IPR006210 493 525 SM00181 Type I EGF

IPR002049 498 537 SM00180 Laminin-type EGF-like

IPR006210 536 568 SM00181 Type I EGF

IPR002049 541 580 SM00180 Laminin-type EGF-like

IPR006210 579 611 SM00181 Type I EGF

IPR002049 584 623 SM00180 Laminin-type EGF-like

IPR006210 622 654 SM00181 Type I EGF

IPR002049 627 666 SM00180 Laminin-type EGF-like

IPR006210 665 699 SM00181 Type I EGF

IPR002049 669 711 SM00180 Laminin-type EGF-like

IPR006210 710 742 SM00181 Type I EGF

IPR002049 715 754 SM00180 Laminin-type EGF-like

IPR006210 753 785 SM00181 Type I EGF

IPR002049 758 797 SM00180 Laminin-type EGF-like

IPR006210 796 828 SM00181 Type I EGF

IPR002049 801 840 SM00180 Laminin-type EGF-like

IPR006210 839 871 SM00181 Type I EGF

IPR002049 844 873 SM00180 Laminin-type EGF-like

ProfileScan NULL 136 861 PS50311 NULL

ScanRegExp IPR006209 166 177 PS00022 EGF-like

IPR006209 166 181 PS01186 EGF-like

IPR006209 209 220 PS00022 EGF-like

IPR006209 209 224 PS01186 EGF-like

IPR006209 252 263 PS00022 EGF-like

IPR006209 252 267 PS01186 EGF-like

IPR006209 295 306 PS00022 EGF-like

IPR006209 295 310 PS01186 EGF-like

IPR006209 338 349 PS00022 EGF-like

IPR006209 338 353 PS01186 EGF-like

IPR006209 381 392 PS00022 EGF-like

IPR006209 381 392 PS01186 EGF-like

IPR006209 427 438 PS00022 EGF-like

IPR006209 427 442 PS01186 EGF-like

IPR006209 470 481 PS00022 EGF-like

IPR006209 470 485 PS01186 EGF-like

IPR006209 513 524 PS00022 EGF-like

IPR006209 513 528 PS01186 EGF-like

IPR006209 556 567 PS00022 EGF-like

IPR006209 556 571 PS01186 EGF-like

IPR006209 599 610 PS00022 EGF-like

IPR006209 599 614 PS01186 EGF-like

IPR006209 642 653 PS00022 EGF-like

IPR006209 642 657 PS01186 EGF-like

IPR006209 687 698 PS00022 EGF-like

IPR006209 687 702 PS01186 EGF-like

IPR006209 730 741 PS00022 EGF-like

IPR006209 730 745 PS01186 EGF-like

IPR006209 773 784 PS00022 EGF-like

IPR006209 773 788 PS01186 EGF-like

IPR006209 816 827 PS00022 EGF-like

IPR006209 816 831 PS01186 EGF-like

IPR006209 859 870 PS00022 EGF-like

IPR006209 859 870 PS01186 EGF-like

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR002049	245	263	PR00011	Laminin-type EGF-like
IPR002049	809	827	PR00011	Laminin-type EGF-like
IPR002049	852	870	PR00011	Laminin-type EGF-like
HMMPfam	IPR011489	72	144	PF07546	EMI
IPR006209	151	177	PF00008	EGF-like
IPR002049	194	233	PF00053	Laminin-type EGF-like
IPR002049	237	276	PF00053	Laminin-type EGF-like
IPR006209	276	306	PF00008	EGF-like
NULL	280	306	PF07974	NULL
IPR002049	323	362	PF00053	Laminin-type EGF-like
IPR002049	366	406	PF00053	Laminin-type EGF-like
NULL	366	392	PF07974	NULL
IPR002049	410	451	PF00053	Laminin-type EGF-like
IPR002049	498	541	PF00053	Laminin-type EGF-like
NULL	498	524	PF07974	NULL
IPR002049	627	670	PF00053	Laminin-type EGF-like
IPR002049	715	754	PF00053	Laminin-type EGF-like
NULL	715	741	PF07974	NULL
NULL	758	784	PF07974	NULL
IPR002049	801	844	PF00053	Laminin-type EGF-like
HMMSmart	IPR006210	150	178	SM00181	Type I EGF
IPR002049	157	190	SM00180	Laminin-type EGF-like
IPR006210	189	221	SM00181	Type I EGF
IPR002049	194	233	SM00180	Laminin-type EGF-like
IPR006210	232	264	SM00181	Type I EGF
IPR002049	237	276	SM00180	Laminin-type EGF-like
IPR006210	275	307	SM00181	Type I EGF
IPR002049	280	319	SM00180	Laminin-type EGF-like
IPR006210	318	350	SM00181	Type I EGF
IPR002049	323	362	SM00180	Laminin-type EGF-like
IPR006210	361	393	SM00181	Type I EGF
IPR002049	366	406	SM00180	Laminin-type EGF-like
IPR006210	405	439	SM00181	Type I EGF
IPR002049	410	451	SM00180	Laminin-type EGF-like
IPR006210	450	482	SM00181	Type I EGF
IPR002049	455	494	SM00180	Laminin-type EGF-like
IPR006210	493	525	SM00181	Type I EGF
IPR002049	498	537	SM00180	Laminin-type EGF-like
IPR006210	536	568	SM00181	Type I EGF
IPR002049	541	580	SM00180	Laminin-type EGF-like
IPR006210	579	611	SM00181	Type I EGF
IPR002049	584	623	SM00180	Laminin-type EGF-like
IPR006210	622	654	SM00181	Type I EGF
IPR002049	627	666	SM00180	Laminin-type EGF-like
IPR006210	665	699	SM00181	Type I EGF
IPR002049	669	711	SM00180	Laminin-type EGF-like
IPR006210	710	742	SM00181	Type I EGF
IPR002049	715	754	SM00180	Laminin-type EGF-like
IPR006210	753	785	SM00181	Type I EGF
IPR002049	758	797	SM00180	Laminin-type EGF-like
IPR006210	796	828	SM00181	Type I EGF
IPR002049	801	840	SM00180	Laminin-type EGF-like
IPR006210	839	871	SM00181	Type I EGF
IPR002049	844	873	SM00180	Laminin-type EGF-like
ProfileScan	NULL	136	861	PS50311	NULL
ScanRegExp	IPR006209	166	177	PS00022	EGF-like
IPR006209	166	181	PS01186	EGF-like
IPR006209	209	220	PS00022	EGF-like
IPR006209	209	224	PS01186	EGF-like
IPR006209	252	263	PS00022	EGF-like
IPR006209	252	267	PS01186	EGF-like
IPR006209	295	306	PS00022	EGF-like
IPR006209	295	310	PS01186	EGF-like
IPR006209	338	349	PS00022	EGF-like
IPR006209	338	353	PS01186	EGF-like
IPR006209	381	392	PS00022	EGF-like
IPR006209	381	392	PS01186	EGF-like
IPR006209	427	438	PS00022	EGF-like
IPR006209	427	442	PS01186	EGF-like
IPR006209	470	481	PS00022	EGF-like
IPR006209	470	485	PS01186	EGF-like
IPR006209	513	524	PS00022	EGF-like
IPR006209	513	528	PS01186	EGF-like
IPR006209	556	567	PS00022	EGF-like
IPR006209	556	571	PS01186	EGF-like
IPR006209	599	610	PS00022	EGF-like
IPR006209	599	614	PS01186	EGF-like
IPR006209	642	653	PS00022	EGF-like
IPR006209	642	657	PS01186	EGF-like
IPR006209	687	698	PS00022	EGF-like
IPR006209	687	702	PS01186	EGF-like
IPR006209	730	741	PS00022	EGF-like
IPR006209	730	745	PS01186	EGF-like
IPR006209	773	784	PS00022	EGF-like
IPR006209	773	788	PS01186	EGF-like
IPR006209	816	827	PS00022	EGF-like
IPR006209	816	831	PS01186	EGF-like
IPR006209	859	870	PS00022	EGF-like
IPR006209	859	870	PS01186	EGF-like

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

SOSUI 896 917 SVGAVTGIVLLLFLVVVLLGLF

Method	From	To	amino acid sequence
SOSUI	896	917	SVGAVTGIVLLLFLVVVLLGLF

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	YES

Length of 3'UTR	3255 bp
Genome contig ID	gi65519420f_64407878
PolyA signal sequence (AATAAA,-29)	+--------+--------+----*----+---- ATACAAAATAAAATGGATTCTCAAACTAACATTAC
Flanking genome sequence (423531 - 423580)	----+--------+--------+--------+--------+----* AAGAATGCCTACTGTTGTGTTGCAAACTGAAAATCTATACATTTTATGTT

Gene/Protein Characteristic Table for mKIAA1781

Features of the cloned DNA sequence

Features of the protein sequence