Order Kazusa clone(s) from : ![]() |
Product ID | ORK01087 |
---|---|
Accession No | AB011103 |
Description | kinesin family member 5C, transcript variant 1 |
Clone name | hg03072 |
Vector information | |
cDNA sequence | DNA sequence (6927 bp) Predicted protein sequence (999 aa) |
HaloTag ORF Clone |
FHC01087
![]() |
Flexi ORF Clone | FXC01087 |
Source | Human adult brain |
Rouge ID |
mKIAA0531
by Kazusa Mouse cDNA Project
|
N-terminal truncation | Coding interruption | |
---|---|---|
cloned DNA seq | No warning | No warning |
Length of 3'UTR | 3685 bp |
---|---|
Genome contig ID | gi89161199f_149249289 |
PolyA signal sequence (AATAAA,-22) |
+----*----+----*----+----*----+---- |
Flanking genome sequence (342232 - 342281) |
----+----*----+----*----+----*----+----*----+----* |
Ensembl ContigView (Add our DAS server as a DAS source)
Chr | f/r | start | end | exon | identity | class | |
---|---|---|---|---|---|---|---|
| 2 | f | 149349289 | 149591519 | 25 | 99.5 | Internal No-hit |
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
Search method | interpro_ID | From | To | Entry | Definition |
---|---|---|---|---|---|
FPrintScan | IPR001752 | 119 | 140 | PR00380 | Kinesin |
IPR001752 | 238 | 255 | PR00380 | Kinesin | |
IPR001752 | 269 | 287 | PR00380 | Kinesin | |
IPR001752 | 319 | 340 | PR00380 | Kinesin | |
HMMPfam | IPR001752 | 56 | 370 | PF00225 | Kinesin |
HMMSmart | IPR001752 | 48 | 377 | SM00129 | Kinesin |
ProfileScan | IPR001752 | 47 | 299 | PS50067 | Kinesin |
ScanRegExp | IPR001752 | 268 | 279 | PS00411 | Kinesin |
![]() |
---|
Primer_f | TGATATAAACCACCATTCTCC |
---|---|
Primer_r | GTGTGTTCTCTGGGCTTTATG |
PCR conditions | 95 °C![]() ![]() ![]() ![]() ![]() ![]() ![]() |
Panel name | GeneBridge 4 |
---|---|
Primer_f | TGATATAAACCACCATTCTCC |
Primer_r | GTGTGTTCTCTGGGCTTTATG |
PCR product length | 104 bp |
PCR conditions | 95 °C![]() ![]() ![]() ![]() |