ROUGE |
Gene/Protein Characteristic Table for mKIAA0393 |
Link to : HUGE | InGAP | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK220338 |
---|---|
hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 2. | |
mbg13346 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6282 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 664 bp Genome contig ID gi65511124f_50350612 PolyA signal sequence
(AATAAA,-17) +----*----+----*----+----*----+----
AAATTTTAATCCCCTATAAATAAAACATGTGTCACFlanking genome sequence
(150664 - 150713) ----+----*----+----*----+----*----+----*----+----*
AAAACTGTAGGCTGAATTTCTTAACCAATTAGACTAGCACATGTGGATCT
KIAA Alignment based on: KIAA0393 DNA sequence
Features of the protein sequence |
Description | |
Coding region: 3..5615
Length: 1871 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |