ROUGE

Gene/Protein Characteristic Table for mKIAA0093

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK122203
Description :	E3 ubiquitin-protein ligase Nedd-4.
Clone Name :	mbg10506 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5330 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2613 bp

Genome contig ID gi65519420f_72695155
PolyA signal sequence
(AATAAA,-22)
+----*----+----*----+----*----+----
TTTCAATTCCACAAATAAAGTTCTATTCTGATTTT
Flanking genome sequence
(187173 - 187222)
----+----*----+----*----+----*----+----*----+----*
AAAAACAAAGCTGTGGCTCCGTTACCTAAAAATGTTTGAGAGTCTCAAGA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0093 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0093	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..2717
Length: 904 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAA12803	100.0	Nedd4 [Mus musc...	Mus musculus
P46935	100.0	E3 ubiquitin-pr...	Mus musculus
EDL84129	96.3	neural precurso...	Rattus norvegicus
Q62940	94.9	E3 ubiquitin-pr...	Rattus norvegicus
AAB63360	100.0	Nedd-4 [Mus mus...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220164	1.8e-57	42.7	mKIAA4011
AK129325	1.5e-52	36.5	mKIAA1301
AK172932	1.5e-50	34.8	mKIAA0322
AB093227	1.4e-42	36.9	mKIAA0312
AK122283	5.8e-36	51.4	mKIAA0439

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

FPrintScan IPR000008 112 124 PR00360 C2

IPR000008 142 155 PR00360 C2

IPR002349 424 437 PR00403 WW

IPR002349 439 453 PR00403 WW

HMMPfam IPR000008 97 183 PF00168 C2

IPR001202 268 297 PF00397 WW/Rsp5/WWP

IPR001202 424 453 PF00397 WW/Rsp5/WWP

IPR001202 479 508 PF00397 WW/Rsp5/WWP

IPR000569 598 903 PF00632 HECT

HMMSmart IPR000008 96 198 SM00239 C2

IPR001202 267 299 SM00456 WW/Rsp5/WWP

IPR001202 423 455 SM00456 WW/Rsp5/WWP

IPR001202 478 510 SM00456 WW/Rsp5/WWP

IPR000569 567 903 SM00119 HECT

ProfileScan IPR000008 97 183 PS50004 C2

IPR001202 266 299 PS50020 WW/Rsp5/WWP

IPR001202 422 455 PS50020 WW/Rsp5/WWP

IPR001202 477 510 PS50020 WW/Rsp5/WWP

IPR000569 569 903 PS50237 HECT

ScanRegExp IPR001202 272 297 PS01159 WW/Rsp5/WWP

IPR001202 428 453 PS01159 WW/Rsp5/WWP

IPR001202 483 508 PS01159 WW/Rsp5/WWP

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000008	112	124	PR00360	C2
IPR000008	142	155	PR00360	C2
IPR002349	424	437	PR00403	WW
IPR002349	439	453	PR00403	WW
HMMPfam	IPR000008	97	183	PF00168	C2
IPR001202	268	297	PF00397	WW/Rsp5/WWP
IPR001202	424	453	PF00397	WW/Rsp5/WWP
IPR001202	479	508	PF00397	WW/Rsp5/WWP
IPR000569	598	903	PF00632	HECT
HMMSmart	IPR000008	96	198	SM00239	C2
IPR001202	267	299	SM00456	WW/Rsp5/WWP
IPR001202	423	455	SM00456	WW/Rsp5/WWP
IPR001202	478	510	SM00456	WW/Rsp5/WWP
IPR000569	567	903	SM00119	HECT
ProfileScan	IPR000008	97	183	PS50004	C2
IPR001202	266	299	PS50020	WW/Rsp5/WWP
IPR001202	422	455	PS50020	WW/Rsp5/WWP
IPR001202	477	510	PS50020	WW/Rsp5/WWP
IPR000569	569	903	PS50237	HECT
ScanRegExp	IPR001202	272	297	PS01159	WW/Rsp5/WWP
IPR001202	428	453	PS01159	WW/Rsp5/WWP
IPR001202	483	508	PS01159	WW/Rsp5/WWP

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	2613 bp
Genome contig ID	gi65519420f_72695155
PolyA signal sequence (AATAAA,-22)	+--------+--------+----*----+---- TTTCAATTCCACAAATAAAGTTCTATTCTGATTTT
Flanking genome sequence (187173 - 187222)	----+--------+--------+--------+--------+----* AAAAACAAAGCTGTGGCTCCGTTACCTAAAAATGTTTGAGAGTCTCAAGA

Gene/Protein Characteristic Table for mKIAA0093

Features of the cloned DNA sequence

Features of the protein sequence