ROUGE |
Gene/Protein Characteristic Table for mKIAA0312 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AB093227 |
---|---|
Upstream regulatory element binding protein 1 (Fragment). | |
mbf01960 [Vector Info] | |
Source : | Mouse brain |
Note : | We replaced mef00849, former representative clones for mKIAA0312 with mbf01960. (2004/6/22) |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 9308 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 503 bp Genome contig ID gi66880665f_145321281 PolyA signal sequence
(AATAAA,-19) +----*----+----*----+----*----+----
TGTTGTGGAGGTTTCAAATAAAGAGCACTCTTCATFlanking genome sequence
(148003 - 148052) ----+----*----+----*----+----*----+----*----+----*
AACTCACTTTTCACAACGGAGTTTTTTTCAAACTGAAAAAGAAAACCCCA
KIAA Alignment based on: KIAA0312 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 1..8805
Length: 2934 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |