ROUGE |
Gene/Protein Characteristic Table for mKIAA0364 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129126 |
---|---|
immunoglobulin superfamily, member 1 isoform 4. betaglycan and inhibin binding protein. |
|
mph01359 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 3532 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 758 bp Genome contig ID gi66880665r_44203341 PolyA signal sequence
(AATAAA,-29) +----*----+----*----+----*----+----
CTTCTGAATAAAGAGAATATTCACTATTTAACTGCFlanking genome sequence
(100000 - 99951) ----+----*----+----*----+----*----+----*----+----*
AAACCAAACCATGGTAGTGGTCTTTTTTTGGTTGTTTGTTCTGTTTTGCA
KIAA Alignment based on: KIAA0364 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 162..2756, 2774..3259
Length: 1026 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage ![]() | |