ROUGE |
Gene/Protein Characteristic Table for mFLJ00068 |
Link to : NEDO | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK131125 |
---|---|
mbg21780 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 5557 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 3026 bp Genome contig ID gi65515060f_104571063 PolyA signal sequence
(AATAAA,-27) +----*----+----*----+----*----+----
TTGTTTATAATAAAAAATAAGTGATTTGCACCGTTFlanking genome sequence
(107428 - 107477) ----+----*----+----*----+----*----+----*----+----*
GACTGGGCATATGCATTCTGGGGGTTTCCACAGAAAATGAGCCTTGGGCA
KIAA Alignment based on: FLJ00068 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 513..1085, 1263..2453, 2531..2788, 3407..3706, 3793..4002, 4084..4557
Length: 1002 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage | |