ROUGE

Gene/Protein Characteristic Table for mFLJ00068

Link to : NEDO \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK131125
Description :
Clone Name :	mbg21780 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 5557 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
YES

Integrity of 3' end

Length of 3'UTR 3026 bp

Genome contig ID gi65515060f_104571063
PolyA signal sequence
(AATAAA,-27)
+----*----+----*----+----*----+----
TTGTTTATAATAAAAAATAAGTGATTTGCACCGTT
Flanking genome sequence
(107428 - 107477)
----+----*----+----*----+----*----+----*----+----*
GACTGGGCATATGCATTCTGGGGGTTTCCACAGAAAATGAGCCTTGGGCA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

FLJ00068 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
FLJ00068	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 513..1085, 1263..2453, 2531..2788, 3407..3706, 3793..4002, 4084..4557
Length: 1002 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAD21375	100.0	mFLJ00068 prote...	Mus musculus
EDL11278	96.0	mCG23536, isofo...	Mus musculus
AAI56163	96.0	Pleckstrin homo...	synthetic construct
EDL92374	88.8	pleckstrin homo...	Rattus norvegicus
NP_001129342	88.8	pleckstrin homo...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK131136	8.1e-40	32.2	mFLJ00128
AK122259	3.6e-19	25.9	mKIAA0362
AK131110	1.2e-07	29.4	mFLJ00018
AK122468	2.6e-06	28.1	mKIAA1209
AK129064	1.7e-05	26.8	mKIAA0142

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000219 589 761 PF00621 DH

HMMSmart IPR000219 589 761 SM00325 DH

IPR001849 775 882 SM00233 Pleckstrin-like

ProfileScan IPR000219 585 762 PS50010 DH

IPR001849 774 880 PS50003 Pleckstrin-like

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000219	589	761	PF00621	DH
HMMSmart	IPR000219	589	761	SM00325	DH
IPR001849	775	882	SM00233	Pleckstrin-like
ProfileScan	IPR000219	585	762	PS50010	DH
IPR001849	774	880	PS50003	Pleckstrin-like

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	YES

Length of 3'UTR	3026 bp
Genome contig ID	gi65515060f_104571063
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- TTGTTTATAATAAAAAATAAGTGATTTGCACCGTT
Flanking genome sequence (107428 - 107477)	----+--------+--------+--------+--------+----* GACTGGGCATATGCATTCTGGGGGTTTCCACAGAAAATGAGCCTTGGGCA

Gene/Protein Characteristic Table for mFLJ00068

Features of the cloned DNA sequence

Features of the protein sequence