Gene/Protein Characteristic Table for mFLJ00018

Length: 4880 bp

Restriction map

Length of 3'UTR	200 bp
Genome contig ID	gi65511124r_23661413
PolyA signal sequence (None)	+----*----+----*----+----*----+---- TCATGGTTATTTTGTTAATTAATTTTATGAAACGC
Flanking genome sequence (100000 - 99951)	----+----*----+----*----+----*----+----*----+----* TGTGTGTTTTGCCTTTCTTGAGGTAATGGGAAATGGGCAGACACCATGAA

KIAA	Alignment based on:
FLJ00018	DNA sequence, AA sequence, Physical map

Coding region: 562..4680

Length: 1372 aa

Entry Exp ID% Protein Source BAD21360 0 100.0 mFLJ00018 prote... Mus musculus Q6KAU7 0 100.0 Pleckstrin homo... Mus musculus EDL24142 0 99.9 pleckstrin homo... Mus musculus NP_620091 0 99.9 common-site lym... Mus musculus AAL93134 0 99.9 common-site lym... Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Entry Exp ID% ROUGE_ID AK122468 1.5e-20 27.6 mKIAA1209 AK122259 9e-08 27.2 mKIAA0362 AK220313 1.2e-06 29.7 mFLJ00298 AK122280 4.4e-06 29.7 mKIAA0424 AK173168 8.7e-06 28.8 mKIAA1415

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000219	134	310	PF00621	DH
	IPR001849	336	439	PF00169	Pleckstrin-like
HMMSmart	IPR000219	134	310	SM00325	DH
	IPR001849	336	441	SM00233	Pleckstrin-like
ProfileScan	IPR000219	130	311	PS50010	DH
	IPR001849	341	439	PS50003	Pleckstrin-like

Method	From	To	amino acid sequence
-	-	-	-