| ROUGE |
Gene/Protein Characteristic Table for mKIAA1564 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK129393 |
|---|---|
| helicase with SNF2 domain 1. | |
| mbh04633 [Vector Info] | |
| Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 3696 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | YES |
Length of 3'UTR 2337 bp Genome contig ID gi65540054r_47198583 PolyA signal sequence
(AAGAAA,-18) +----*----+----*----+----*----+----
CAGGAGGTGAAAAGAAAAAGAAAAAAACAAAAAACFlanking genome sequence
(99973 - 99924) ----+----*----+----*----+----*----+----*----+----*
AAAAAAAAACAAAAAACTTGTACCCAATTGCTCCCAATTTTGAGAGGATT
KIAA Alignment based on: KIAA1564 DNA sequence, AA sequence
Features of the protein sequence |
Description | |
Coding region: 35..538, 628..1350, 1559..2122, 2303..2479, 2916..3554
Length: 868 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage
| |