ROUGE |
Gene/Protein Characteristic Table for mKIAA0302 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK172931 |
---|---|
Ras and Rab interactor 1. | |
mbg05848 [Vector Info] | |
Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 6544 bp
cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | YES |
Length of 3'UTR 624 bp Genome contig ID gi65553144f_4420773 PolyA signal sequence
(ATTAAA,-20) +----*----+----*----+----*----+----
CTATCCAAGGAGGTGATTAAACAGCTCGACTTCTCFlanking genome sequence
(120372 - 120421) ----+----*----+----*----+----*----+----*----+----*
TCACTGCCTCTGGGTGTTGTTGCTTTCCTGACCGTAGCCTCTCCTGGTCT
KIAA Alignment based on: KIAA0302 DNA sequence
Features of the protein sequence |
Description | |
Coding region: 2..5920
Length: 1972 aa
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage | |