KIAA0302

Product ID	ORK00045
Accession No	AB008567
Description	spectrin, beta, non-erythrocytic 2
Clone name	hf00409s2
Vector information	The cDNA fragment was inserted at the SalI-NotI site of the ... The cDNA fragment was inserted at the SalI-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the SalI adapter (5'TCGACCCACG CGTCCG3') and inserted at the SalI site of the vector. The 3'end of the cDNA was inserted at the NotI site of the vector. This cDNA clone hf00409s2 has an irregular adapter sequence (GTCGACCCAC GCGTGGGTT) instead of regular one (GTCGACCCAC GCGTCCG).
cDNA sequence	DNA sequence (7864 bp) Predicted protein sequence (2414 aa)
HaloTag ORF Clone	FHC00045
Flexi ORF Clone	FXC00045
Source	Human adult brain
Rouge ID	mKIAA0302 by Kazusa Mouse cDNA Project
Note	We replaced hf00409s1 and hf00409, former representative clones for KIAA0302 with hf00409s2. (2008/8/27,2006/4/25)

Length: 7864 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	619 bp
Genome contig ID	gi51511727r_66109299
PolyA signal sequence (ATTAAA,-20)	+--------+--------+----*----+---- CTGGCCAAGGAGGTGATTAAACAGCTCAGCTTCTC
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TCACCGCCTCTGGGTGTCTTTGCTTTCCTGACCACAGCCTCTCTGCCCAA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	11	r	66209299	66245446	37	99.9	Perfect prediction

Length: 2414 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
BAA32700	100.0	beta-spectrin I...	Homo sapiens
O15020	100.0	Spectrin beta c...	Homo sapiens
XP_508579	99.4	spectrin, beta,...	Pan troglodytes
XP_001108262	98.7	spectrin, beta,...	Macaca mulatta
EAW74560	99.0	spectrin, beta,...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
AB046862	4.2e-106	42.7	KIAA1642
AB018271	3.7e-07	21.5	KIAA0728
AB037785	8.1e-06	43.4	KIAA1364
AB018293	1.2e-05	29.8	KIAA0750
AB020710	0.00018	23.3	KIAA0903

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR001605	2245	2264	PR00683	Spectrin/pleckstrin-like
	IPR001605	2265	2286	PR00683	Spectrin/pleckstrin-like
	IPR001605	2307	2324	PR00683	Spectrin/pleckstrin-like
	IPR001605	2327	2345	PR00683	Spectrin/pleckstrin-like
HMMPfam	IPR001715	82	185	PF00307	Calponin-like actin-binding
	IPR001715	201	305	PF00307	Calponin-like actin-binding
	IPR002017	329	439	PF00435	Spectrin repeat
	IPR002017	449	553	PF00435	Spectrin repeat
	IPR002017	555	663	PF00435	Spectrin repeat
	IPR002017	665	769	PF00435	Spectrin repeat
	IPR002017	771	874	PF00435	Spectrin repeat
	IPR002017	876	980	PF00435	Spectrin repeat
	IPR002017	982	1087	PF00435	Spectrin repeat
	IPR002017	1089	1194	PF00435	Spectrin repeat
	IPR002017	1196	1283	PF00435	Spectrin repeat
	IPR002017	1302	1405	PF00435	Spectrin repeat
	IPR002017	1407	1510	PF00435	Spectrin repeat
	IPR002017	1512	1610	PF00435	Spectrin repeat
	IPR002017	1612	1716	PF00435	Spectrin repeat
	IPR002017	1718	1823	PF00435	Spectrin repeat
	IPR002017	1825	1929	PF00435	Spectrin repeat
	IPR002017	1931	2035	PF00435	Spectrin repeat
	IPR002017	2037	2099	PF00435	Spectrin repeat
	IPR001849	2243	2352	PF00169	Pleckstrin-like
HMMSmart	IPR001715	83	183	SM00033	Calponin-like actin-binding
	IPR001715	202	300	SM00033	Calponin-like actin-binding
	IPR002017	332	438	SM00150	Spectrin repeat
	IPR002017	452	552	SM00150	Spectrin repeat
	IPR002017	558	662	SM00150	Spectrin repeat
	IPR002017	668	768	SM00150	Spectrin repeat
	IPR002017	774	873	SM00150	Spectrin repeat
	IPR002017	879	979	SM00150	Spectrin repeat
	IPR002017	985	1086	SM00150	Spectrin repeat
	IPR002017	1092	1193	SM00150	Spectrin repeat
	IPR002017	1199	1299	SM00150	Spectrin repeat
	IPR002017	1305	1404	SM00150	Spectrin repeat
	IPR002017	1410	1509	SM00150	Spectrin repeat
	IPR002017	1515	1609	SM00150	Spectrin repeat
	IPR002017	1615	1715	SM00150	Spectrin repeat
	IPR002017	1721	1822	SM00150	Spectrin repeat
	IPR002017	1828	1928	SM00150	Spectrin repeat
	IPR002017	1934	2034	SM00150	Spectrin repeat
	IPR002017	2040	2280	SM00150	Spectrin repeat
	IPR001849	2243	2354	SM00233	Pleckstrin-like
ProfileScan	IPR001715	81	185	PS50021	Calponin-like actin-binding
	IPR001715	200	302	PS50021	Calponin-like actin-binding
	IPR001849	2242	2352	PS50003	Pleckstrin-like
ScanRegExp	IPR001589	83	92	PS00019	Actin-binding
ScanRegExp	IPR001589	157	181	PS00020	Actin-binding

Primer_f	AGAGCAGCTGGAGATGGAGTG
Primer_r	CCTTCTGCCTTCTGGTTCCTC
PCR conditions	95 °C30 sec55 °C30 sec72 °C60 sec30 cycles

Panel name	GeneBridge 4
Primer_f	AGAGCAGCTGGAGATGGAGTG
Primer_r	CCTTCTGCCTTCTGGTTCCTC
PCR product length	163 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles