| ROUGE |
Gene/Protein Characteristic Table for mKIAA0272 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK129108 |
|---|---|
| Brca1 associated protein 1. ubiquitin C-terminal hydrolase X4. |
|
| mbh03915 [Vector Info] | |
| Source : | Mouse brain |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 3314 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1090 bp Genome contig ID gi65540054f_29283420 PolyA signal sequence
(AATAAA,-8) +----*----+----*----+----*----+----
GAATCAGTGAGTGAATAAAAATGTGCTAATAAATGFlanking genome sequence
(108350 - 108399) ----+----*----+----*----+----*----+----*----+----*
ATCTTCTGGTTGCTATCTCGAGGTCGGTAGGCTGGGCTGTGGTGGAATGA
KIAA Alignment based on: KIAA0272 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 2..2224
Length: 740 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage
| |