ROUGE

Gene/Protein Characteristic Table for mKIAA0272

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129108
Description :	Brca1 associated protein 1. ubiquitin C-terminal hydrolase X4.
Clone Name :	mbh03915 [Vector Info]
Source :	Mouse brain

Features of the cloned DNA sequence	Description

Length: 3314 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 1090 bp

Genome contig ID gi65540054f_29283420
PolyA signal sequence
(AATAAA,-8)
+----*----+----*----+----*----+----
GAATCAGTGAGTGAATAAAAATGTGCTAATAAATG
Flanking genome sequence
(108350 - 108399)
----+----*----+----*----+----*----+----*----+----*
ATCTTCTGGTTGCTATCTCGAGGTCGGTAGGCTGGGCTGTGGTGGAATGA

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0272 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0272	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 2..2224
Length: 740 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EDL24802	99.9	Brca1 associate...	Mus musculus
Q99PU7	99.9	Ubiquitin carbo...	Mus musculus
EDL24803	98.1	Brca1 associate...	Mus musculus
XP_541853	94.2	similar to BRCA...	Canis lupus fam...
XP_001089173	94.0	similar to BRCA...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK017925	2.8e-17	40.9	mKIAA4038

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001578 15 244 PD350662 Peptidase C12

HMMPfam IPR001578 16 228 PF01088 Peptidase C12

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001578	15	244	PD350662	Peptidase C12
HMMPfam	IPR001578	16	228	PF01088	Peptidase C12

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	1090 bp
Genome contig ID	gi65540054f_29283420
PolyA signal sequence (AATAAA,-8)	+--------+--------+----*----+---- GAATCAGTGAGTGAATAAAAATGTGCTAATAAATG
Flanking genome sequence (108350 - 108399)	----+--------+--------+--------+--------+----* ATCTTCTGGTTGCTATCTCGAGGTCGGTAGGCTGGGCTGTGGTGGAATGA

Gene/Protein Characteristic Table for mKIAA0272

Features of the cloned DNA sequence

Features of the protein sequence