ROUGE

Gene/Protein Characteristic Table for mKIAA4038

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK017925
Description :	Ubiquitin carboxyl-terminal hydrolase isozyme L5.
Clone Name :	mie24050 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 1294 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 206 bp

Genome contig ID gi65488608f_143509364
PolyA signal sequence
(AATAAA,-19)
+----*----+----*----+----*----+----
CATGTAGTGCATATTAAATAAAAGTGACGAAAAAG
Flanking genome sequence
(129636 - 129685)
----+----*----+----*----+----*----+----*----+----*
TGCTGGCTAAACTCCATTCTTCAATTCTGGATCTGGGAGTTCTTGGTACT

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 18..1085
Length: 356 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
EDL39509	4.7e-141	100.0	ubiquitin carbo...	Mus musculus
AAD50311	1e-129	100.0	ubiquitin C-ter...	Mus musculus
EAW91233	5.2e-129	92.8	ubiquitin carbo...	Homo sapiens
Q9WUP7	6e-129	99.7	Ubiquitin carbo...	Mus musculus
EDM09603	5.5e-128	99.1	rCG45997 [Rattu...	Rattus norvegicus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129108	2.4e-27	40.6	mKIAA0272

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

BlastProDom IPR001578 36 251 PD350662 Peptidase C12

HMMPfam IPR001578 35 239 PF01088 Peptidase C12

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR001578	36	251	PD350662	Peptidase C12
HMMPfam	IPR001578	35	239	PF01088	Peptidase C12

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	206 bp
Genome contig ID	gi65488608f_143509364
PolyA signal sequence (AATAAA,-19)	+--------+--------+----*----+---- CATGTAGTGCATATTAAATAAAAGTGACGAAAAAG
Flanking genome sequence (129636 - 129685)	----+--------+--------+--------+--------+----* TGCTGGCTAAACTCCATTCTTCAATTCTGGATCTGGGAGTTCTTGGTACT

Gene/Protein Characteristic Table for mKIAA4038

Features of the cloned DNA sequence

Features of the protein sequence