ROUGE |
Gene/Protein Characteristic Table for mKIAA0247 |
Link to : HUGE | SWISS-PROT/TrEMBL | |
Features : DNA sequence | Protein sequence | |
Accession No. : | AK129100 |
---|---|
mpm12222 [Vector Info] | |
Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
---|---|---|
Length: 4835 bp
![]() |
cloned DNA seq. | |
Warning for N-terminal truncation: | NO |
Warning for coding interruption: | NO |
Length of 3'UTR 3719 bp Genome contig ID gi65532617f_77552025 PolyA signal sequence
(AATAAA,-21) +----*----+----*----+----*----+----
CATTTCTAAATAATAATAAAAATTCTTATGAAGGCFlanking genome sequence
(190065 - 190114) ----+----*----+----*----+----*----+----*----+----*
AGATGTGAGATGTAGTCCTTCCCAAAAATAGTTTTTCAGAACTCTAGATG
KIAA Alignment based on: KIAA0247 DNA sequence, AA sequence, Physical map
Features of the protein sequence |
Description | |
Coding region: 142..1116
Length: 324 aa
![]() |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
No significant homologues
How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage ![]() | |