KIAA0213

Product ID	ORK05920
Accession No	D86968
Description	mitogen-activated protein kinase kinase kinase 4, transcript variant 2
Clone name	ha04841s1
Vector information	The cDNA fragment was originally inserted at Apa I-NotI site ... The cDNA fragment was originally inserted at Apa I-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The adjacent sequence to the 5' end of the cDNA is as follows: GGGCCCCCCC TCGAGGTCGA CGGTATCGAT AAGCTTGATT-5' end of cDNA.
cDNA sequence	DNA sequence (5396 bp) Predicted protein sequence (1626 aa)
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0213 by Kazusa Mouse cDNA Project
Note	We replaced ha04841, former representative clones for KIAA0213 with ha04841s1. (2002/12/27)

Length: 5396 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	514 bp
Genome contig ID	gi89161210f_161232749
PolyA signal sequence (AATAAA,-27)	+--------+--------+----*----+---- CTTTTTTCAATAAATGGTTTATTTTAGGAAAGCTC
Flanking genome sequence (225659 - 225708)	----+--------+--------+--------+--------+----* AGTTATATTGTCTTTTAATGGTTAACACTTATGAGCCAACGCAGTATGAT

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	6	f	161332749	161458406	26	99.7	Perfect prediction

Length: 1626 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
EAW47586	100.0	mitogen-activat...	Homo sapiens
AAI46771	99.9	Mitogen-activat...	Homo sapiens
CAH70639	99.9	mitogen-activat...	Homo sapiens
XP_862916	93.7	similar to mito...	Canis lupus fam...
AAC53127	89.2	MEK kinase 4b [...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	HUGE_ID
D86959	9.8e-10	35.6	KIAA0204
AB032968	8.2e-08	29.8	KIAA1142
AB067488	8.2e-08	30.0	KIAA1901
AB037782	8.9e-08	33.2	KIAA1361
AB033090	1.2e-07	33.7	KIAA1264

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
BlastProDom	IPR000719	1367	1607	PD000001	Protein kinase
HMMPfam	IPR000719	1361	1619	PF00069	Protein kinase
HMMSmart	IPR001245	1361	1619	SM00219	Tyrosine protein kinase
HMMSmart	IPR002290	1361	1619	SM00220	Serine/threonine protein kinase
ProfileScan	IPR000719	1361	1619	PS50011	Protein kinase
ScanRegExp	IPR000719	1367	1390	PS00107	Protein kinase
ScanRegExp	IPR008271	1477	1489	PS00108	Serine/threonine protein kinase

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	ACTACTGTACACGGACCATCG
Primer_r	TAAAAACAAGGTATGGGACGC
PCR product length	137 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles