ROUGE

Gene/Protein Characteristic Table for mKIAA0210

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220251
Description :	TBC1 domain family, member 5.
Clone Name :	mic20042 [Vector Info]
Source :	Mouse adult pancreatic islet

Features of the cloned DNA sequence	Description

Length: 5579 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 2814 bp

Genome contig ID gi65550231r_48165633
PolyA signal sequence
(AATAAA,-17)
+----*----+----*----+----*----+----
GCCCACTTGATGTGTACTAATAAAGGACTACTGAG
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
AACTGGGATCACATCCACTTCTTCCAGTCACATAGCTCTGGGGTCCGGAG

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0210 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0210	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 300..2765
Length: 821 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
NP_082438	0	100.0	TBC1 domain fam...	Mus musculus
Q80XQ2	0	99.9	TBC1 domain fam...	Mus musculus
NP_001128234	0	92.1	TBC1 domain fam...	Rattus norvegicus
NP_001127853	0	85.6	TBC1 domain fam...	Homo sapiens
XP_001084769	1.6e-213	83.5	TBC1 domain fam...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output)
No significant homologues
Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR000195 128 389 PF00566 RabGAP/TBC

HMMSmart IPR000195 84 390 SM00164 RabGAP/TBC

ProfileScan IPR000195 81 362 PS50086 RabGAP/TBC

NULL 516 545 PS50322 NULL

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000195	128	389	PF00566	RabGAP/TBC
HMMSmart	IPR000195	84	390	SM00164	RabGAP/TBC
ProfileScan	IPR000195	81	362	PS50086	RabGAP/TBC
NULL	516	545	PS50322	NULL

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	2814 bp
Genome contig ID	gi65550231r_48165633
PolyA signal sequence (AATAAA,-17)	+--------+--------+----*----+---- GCCCACTTGATGTGTACTAATAAAGGACTACTGAG
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACTGGGATCACATCCACTTCTTCCAGTCACATAGCTCTGGGGTCCGGAG

Gene/Protein Characteristic Table for mKIAA0210

Features of the cloned DNA sequence

Features of the protein sequence