KIAA0210

Product ID	ORK00459
Accession No	D86965
Description	TBC1 domain family, member 5, transcript variant 2
Clone name	ha02313
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (6611 bp) Predicted protein sequence (801 aa)
HaloTag ORF Clone	FHC00459
Flexi ORF Clone	FXC00459
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0210 by Kazusa Mouse cDNA Project

Length: 6611 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	2559 bp
Genome contig ID	gi89161205r_17074903
PolyA signal sequence (ATTAAA,-23)	+--------+--------+----*----+---- AGTTACAGTGCTATTAAAGAATATGTGCTCCTTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* TATTATATTATCAGATACTTATGTTTAATTGTACATTTTTTAAATCCTGA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	r	17174903	17757403	21	99.3	Internal No-hit

Length: 801 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
Q92609	100.0	TBC1 domain fam...	Homo sapiens
EAW64285	99.9	TBC1 domain fam...	Homo sapiens
XP_001161013	99.9	TBC1 domain fam...	Pan troglodytes
EAW64284	99.6	TBC1 domain fam...	Homo sapiens
XP_001084887	98.2	TBC1 domain fam...	Macaca mulatta

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR000195	128	389	PF00566	RabGAP/TBC
HMMSmart	IPR000195	84	390	SM00164	RabGAP/TBC
ProfileScan	IPR000195	87	365	PS50086	RabGAP/TBC

Prediction of transmembrane (TM) segments

Method	No.	N terminal	transmembrane region	C terminal	type	length
SOSUI2	1	356	VVWDALFADGLSLGLVDYIFVAM	378	PRIMARY	23

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	GTGTGCTGTTAGGTGAAAGAC
Primer_r	AAACTCAGGAATGCACTACTC
PCR product length	177 bp
PCR conditions	95 °C15 sec66 °C60 sec30 cycles