KIAA0129

Product ID	ORK07197
Accession No	D50919
Description	tripartite motif containing 14, transcript variant 1
Clone name	ha00496
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (4454 bp) Predicted protein sequence (442 aa)
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0129 by Kazusa Mouse cDNA Project

Length: 4454 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	No warning	No warning

Integrity of 3' end

Length of 3'UTR	3115 bp
Genome contig ID	gi89161216r_99786458
PolyA signal sequence (AATAAA,-26)	+--------+--------+----*----+---- ATTTGGTTTAATAAAATGTGAATAATGTCCCTTTT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* AACCATGGTCTTCACTGGGAGTTCATGTTGCTTCAAGTCCCTAGCACCCA

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	9	r	99886458	99921301	6	99.1	Perfect prediction

Length: 442 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q14142	2.7e-183	100.0	Tripartite moti...	Homo sapiens
EAW58875	2.5e-181	99.3	tripartite moti...	Homo sapiens
XP_520143	1.8e-179	97.3	tripartite moti...	Pan troglodytes
XP_001113460	1.5e-175	95.0	similar to trip...	Macaca mulatta
Q8BVW3	3e-140	77.4	Tripartite moti...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
FPrintScan	IPR000315	33	50	PR01406	Zinc finger
	IPR000315	52	66	PR01406	Zinc finger
	IPR003879	265	282	PR01407	Butyrophylin-like
	IPR003879	304	328	PR01407	Butyrophylin-like
	IPR003879	335	348	PR01407	Butyrophylin-like
	IPR003879	382	406	PR01407	Butyrophylin-like
	IPR003879	413	431	PR01407	Butyrophylin-like
HMMPfam	IPR000315	19	61	PF00643	Zinc finger
HMMPfam	IPR003877	319	440	PF00622	SPla/RYanodine receptor SPRY
HMMSmart	IPR000315	19	61	SM00336	Zinc finger
	IPR006574	266	318	SM00589	SPRY-associated
	IPR003877	319	442	SM00449	SPla/RYanodine receptor SPRY
ProfileScan	IPR000315	24	58	PS50119	Zinc finger
ProfileScan	IPR001870	249	442	PS50188	B302

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	AGAATACCAGGCAGACAGAAC
Primer_r	AGGGATGGGCAGAAATGTTGG
PCR product length	220 bp
PCR conditions	95 °C15 sec62 °C60 sec30 cycles