| ROUGE |
Gene/Protein Characteristic Table for mKIAA0123 |
| Link to : HUGE | SWISS-PROT/TrEMBL | |
| Features : DNA sequence | Protein sequence | |
| Accession No. : | AK004549 |
|---|---|
| Mitochondrial processing peptidase alpha subunit, mitochondrial precursor. | |
| mph00209 [Vector Info] | |
| Source : | Mouse embryonic tail |
Features of the cloned DNA sequence |
Description | |
|---|---|---|
Length: 3063 bp
|
| cloned DNA seq. | |
Warning for N-terminal truncation: | YES |
Warning for coding interruption: | NO |
Length of 3'UTR 1533 bp Genome contig ID gi66880554f_26222097 PolyA signal sequence
(AATAAA,-20)
ATATAAATATGGAAAAATAAATGATTTAGAAGACTFlanking genome sequence
(107189 - 107238)
AGAGTGGATGCCCCTAGGTGTCTGTACATTCAAGGCTATGTCTGAAGGGG
KIAA Alignment based on: KIAA0123 DNA sequence
Features of the protein sequence |
Description | |
Coding region: 1..1530
Length: 509 aa
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
 |
|
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
|
How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage 
| |
