| 
Order Kazusa clone(s) from :  | 
| Product ID | ORK07716 | 
|---|---|
| Accession No | D50913 | 
| Description | peptidase (mitochondrial processing) alpha, transcript variant 1 | 
| Clone name | ha01523s1 | 
| Vector information | |
| cDNA sequence | DNA sequence (2083 bp) Predicted protein sequence (528 aa)  | 
| 
    
     
    HaloTag ORF Clone  | 
    
    
    
     
    FHC07716
     
     
     | 
| Flexi ORF Clone | FXC07716 | 
| Source | Myeloblast cell line (KG-1) | 
| Rouge ID | 
    mKIAA0123
    
    by Kazusa Mouse cDNA Project
     | 
| Note | We replaced ha01523, former representative clones for KIAA0123 with ha01523s1. (2008/8/27) | 
 Length: 2083 bp
 Physical map
    
 Restriction map
 Prediction of protein coding region (GeneMark analysis).
    | N-terminal truncation | Coding interruption | |
|---|---|---|
| cloned DNA seq | Warning | No warning | 
 Integrity of 3' end
    | Length of 3'UTR | 496 bp | 
|---|---|
| Genome contig ID | gi89161216f_138324933 | 
| PolyA signal sequence (AATAAA,-23)  | 
            +----*----+----*----+----*----+----  | 
        
| Flanking genome sequence (113102 - 113151)  | 
            ----+----*----+----*----+----*----+----*----+----*  | 
        
 
        Length: 528 aa
        Result of homology search against nr database 
        (FASTA output,
	Multiple alignment)![]()  | 
        
        
  | 
The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.
        Result of homology search against HUGE database
        (FASTA output,
	Multiple alignment)
	Result of motif / domain search (InterProScan and SOSUI)
 Result of InterProScan
 Chromosome No. 4
 Experimental conditions| Panel name | Stanford G3 | 
|---|---|
| Primer_f | TTCCCGTGCGTGTTAGTTTGG | 
| Primer_r | TTCACCTGCTTCCTGGCTTGC | 
| PCR product length | 279 bp | 
| PCR conditions | 95 °C 15 sec 64 °C 60 sec 30 cycles |