KIAA0123

Product ID	ORK07716
Accession No	D50913
Description	peptidase (mitochondrial processing) alpha, transcript variant 1
Clone name	ha01523s1
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (2083 bp) Predicted protein sequence (528 aa)
HaloTag ORF Clone	FHC07716
Flexi ORF Clone	FXC07716
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0123 by Kazusa Mouse cDNA Project
Note	We replaced ha01523, former representative clones for KIAA0123 with ha01523s1. (2008/8/27)

Length: 2083 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	496 bp
Genome contig ID	gi89161216f_138324933
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- AGCTTCCCTGGTAATAAAGAGCTGGCATCTTTCTT
Flanking genome sequence (113102 - 113151)	----+--------+--------+--------+--------+----* AGCACGGTGTTTTCCTTCTCGCCTGGGGAGGGGCGGTTCTTAAGGGCTGT

Length: 528 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	ID%	Protein	Source
AAH33103	100.0	PMPCA protein [...	Homo sapiens
Q10713	100.0	Mitochondrial-p...	Homo sapiens
AAH22949	99.8	PMPCA protein [...	Homo sapiens
Q5R513	98.7	Mitochondrial-p...	Pongo abelii
CAH93153	98.7	hypothetical pr...	Pongo abelii

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR011765	80	230	PF00675	Peptidase M16
HMMPfam	IPR007863	235	434	PF05193	Peptidase M16
ScanRegExp	IPR001431	100	123	PS00143	Peptidase M16

Primer_f
Primer_r
PCR conditions	test

Panel name	Stanford G3
Primer_f	TTCCCGTGCGTGTTAGTTTGG
Primer_r	TTCACCTGCTTCCTGGCTTGC
PCR product length	279 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles