ROUGE

Gene/Protein Characteristic Table for mKIAA0116

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK129057
Description :	Exosome complex exonuclease RRP42.
Clone Name :	mpk02408 [Vector Info]
Source :	Mouse embryonic tail

Features of the cloned DNA sequence	Description

Length: 987 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
YES

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 124 bp

Genome contig ID gi65519420f_123031053
PolyA signal sequence
(AATAAA,-23)
+----*----+----*----+----*----+----
TGTAAATGTAAAAATAAAGTCTATTTTTTTTGGTC
Flanking genome sequence
(122850 - 122899)
----+----*----+----*----+----*----+----*----+----*
CATTGGTGTTGTTAGCATCTCCAGCTTTATACCAAGACACCATCCTGCTT

Genomic structure deduced by Blast search against draft genome sequences
Comparison with the corresponding KIAA cDNA.

KIAA Alignment based on:

KIAA0116 DNA sequence, AA sequence, Physical map

KIAA	Alignment based on:
KIAA0116	DNA sequence, AA sequence, Physical map

Features of the protein sequence	Description

Coding region: 3..863
Length: 286 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
AAH94932	4.6e-128	99.7	Exosome compone...	Mus musculus
AAH52656	1e-127	99.3	Exosome compone...	Mus musculus
EDL76765	1.5e-126	97.9	exosome compone...	Rattus norvegicus
Q9D0M0	1.7e-123	96.9	Exosome complex...	Mus musculus
Q15024	2.4e-123	95.8	Exosome complex...	Homo sapiens

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK220227	4.9e-22	30.9	mKIAA4013

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001247 26 161 PF01138 3' exoribonuclease

IPR001247 191 257 PF03725 3' exoribonuclease

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001247	26	161	PF01138	3' exoribonuclease
IPR001247	191	257	PF03725	3' exoribonuclease

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) How to obtain anti mKIAA antibodies Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	YES
Warning for coding interruption:	NO

Length of 3'UTR	124 bp
Genome contig ID	gi65519420f_123031053
PolyA signal sequence (AATAAA,-23)	+--------+--------+----*----+---- TGTAAATGTAAAAATAAAGTCTATTTTTTTTGGTC
Flanking genome sequence (122850 - 122899)	----+--------+--------+--------+--------+----* CATTGGTGTTGTTAGCATCTCCAGCTTTATACCAAGACACCATCCTGCTT

Gene/Protein Characteristic Table for mKIAA0116

Features of the cloned DNA sequence

Features of the protein sequence