KIAA0116

Product ID	ORK00021
Accession No	D29958
Description	exosome component 7, transcript variant 1
Clone name	ha00800
Vector information	The cDNA fragment was inserted at the EcoRV-NotI site of the ... The cDNA fragment was inserted at the EcoRV-NotI site of the pBluescript II SK(+) vector (GenBank Accession No. X52328, AmpR). The 5' end of the cDNA was repaired and ligated with the EcoRV (blunt-end ligation) site without using any linker or adapter. The 3' end of the cDNA was inserted at the NotI site of the vector.
cDNA sequence	DNA sequence (1011 bp) Predicted protein sequence (290 aa)
HaloTag ORF Clone	FHC00021
Flexi ORF Clone	FXC00021
Source	Myeloblast cell line (KG-1)
Rouge ID	mKIAA0116 by Kazusa Mouse cDNA Project

Length: 1011 bp

Physical map

Restriction map

Prediction of protein coding region (GeneMark analysis).

	N-terminal truncation	Coding interruption
cloned DNA seq	Warning	No warning

Integrity of 3' end

Length of 3'UTR	137 bp
Genome contig ID	gi89161205f_44892776
PolyA signal sequence (ATTAAA,-26)	+--------+--------+----*----+---- ACATGTAAAATTAAAGGCTATTTTCTGGTCTGGTT
Flanking genome sequence (135198 - 135247)	----+--------+--------+--------+--------+----* TGGTATGTCTAGAGTTCTTCAGTTGAAGCCAAGGCACCATTCAGTGACCC

Ensembl ContigView (Add our DAS server as a DAS source)

	Chr	f/r	start	end	exon	identity	class
Ensembl gnome browser	3	f	44992776	45027972	8	99.8	Perfect prediction

Length: 290 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q15024	2.1e-128	100.0	Exosome complex...	Homo sapiens
EAW64731	4.2e-128	99.7	exosome compone...	Homo sapiens
2NN6	4.3e-128	99.7	Structure of th...	Homo sapiens
BAG38096	7e-127	99.3	unnamed protein...	Homo sapiens
XP_533858	3.1e-126	97.2	similar to Exos...	Canis lupus fam...

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against HUGE database (FASTA output, Multiple alignment)

No significant homologues

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001247	30	165	PF01138	Exoribonuclease
HMMPfam	IPR015847	195	261	PF03725	Exoribonuclease

Primer_f
Primer_r
PCR conditions	test

Panel name	Genebridge 4
Primer_f	GATGATGGAGACTGGCAAGCG
Primer_r	TCCACAGTTGAGCAGTTGATG
PCR product length	142 bp
PCR conditions	95 °C15 sec64 °C60 sec30 cycles