ROUGE

Gene/Protein Characteristic Table for mKIAA4013

Link to : HUGE \| SWISS-PROT/TrEMBL
Features : DNA sequence \| Protein sequence

Accession No. :	AK220227
Description :	Exosome complex exonuclease RRP43.
Clone Name :	mnj12200 [Vector Info]
Source :	Mouse NKT cells

Features of the cloned DNA sequence	Description

Length: 1270 bp
Physical map
Restriction map
Prediction of protein coding region (GeneMark analysis) for :
cloned DNA seq.
Warning for N-terminal truncation:
NO

Warning for coding interruption:
NO

Integrity of 3' end

Length of 3'UTR 99 bp

Genome contig ID gi65492966r_54262900
PolyA signal sequence
(AATAAA,-31)
+----*----+----*----+----*----+----
ACTAAATAAATACCTAATTCCATTCTTTGAAAGAT
Flanking genome sequence
(100000 - 99951)
----+----*----+----*----+----*----+----*----+----*
ATTTCTAGTCCTTACGTTGTTTCTGCGATTGGTATGTACAGGAAAACATT

Genomic structure deduced by Blast search against draft genome sequences

Features of the protein sequence	Description

Coding region: 245..1168
Length: 308 aa

Result of homology search against nr database (FASTA output, Multiple alignment)

Entry	Exp	ID%	Protein	Source
Q9D753	7e-116	100.0	Exosome complex...	Mus musculus
AAH59089	1.5e-115	99.6	Exosome compone...	Mus musculus
EDL35278	5.8e-114	99.6	exosome compone...	Mus musculus
EDM14921	1.5e-113	97.1	exosome compone...	Rattus norvegicus
AAH67250	3.1e-113	100.0	Exosc8 protein ...	Mus musculus

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of homology search against other ROUGE database (FASTA output, Multiple alignment)

Entry	Exp	ID%	ROUGE_ID
AK129057	3.6e-20	30.9	mKIAA0116

The numbers on the left and right sides of a black line in the graphical overview indicate the lengths (in amino acid residues) of the non-homologous N-terminal and C-terminal portions flanking the homologous region (indicated by the black line), respectively.

Result of motif / domain search (InterProScan and SOSUI)

[ zoom out (x2) ]

Result of InterProScan

Search method interpro_ID From To Entry Definition

HMMPfam IPR001247 63 198 PF01138 3' exoribonuclease

IPR001247 223 290 PF03725 3' exoribonuclease

Prediction of transmembrane (TM) segments

Method From To amino acid sequence

- - - -

Search method	interpro_ID	From	To	Entry	Definition
HMMPfam	IPR001247	63	198	PF01138	3' exoribonuclease
IPR001247	223	290	PF03725	3' exoribonuclease

Method	From	To	amino acid sequence
-	-	-	-

How to obtain mKIAA clone(s) Back to the ROUGE Protein Database homepage

	cloned DNA seq.
Warning for N-terminal truncation:	NO
Warning for coding interruption:	NO

Length of 3'UTR	99 bp
Genome contig ID	gi65492966r_54262900
PolyA signal sequence (AATAAA,-31)	+--------+--------+----*----+---- ACTAAATAAATACCTAATTCCATTCTTTGAAAGAT
Flanking genome sequence (100000 - 99951)	----+--------+--------+--------+--------+----* ATTTCTAGTCCTTACGTTGTTTCTGCGATTGGTATGTACAGGAAAACATT

Gene/Protein Characteristic Table for mKIAA4013

Features of the cloned DNA sequence

Features of the protein sequence